ID: 994465686

View in Genome Browser
Species Human (GRCh38)
Location 5:100126897-100126919
Sequence CTTCATAAGCAGAATATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994465684_994465686 30 Left 994465684 5:100126844-100126866 CCTTCTGTAATATTAAGTAATAT No data
Right 994465686 5:100126897-100126919 CTTCATAAGCAGAATATGAAAGG No data
994465685_994465686 1 Left 994465685 5:100126873-100126895 CCAGAAAGATGAAAACTTAAGAC No data
Right 994465686 5:100126897-100126919 CTTCATAAGCAGAATATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994465686 Original CRISPR CTTCATAAGCAGAATATGAA AGG Intergenic
No off target data available for this crispr