ID: 994467662

View in Genome Browser
Species Human (GRCh38)
Location 5:100159043-100159065
Sequence ATGCCCTTCTAGAATAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994467659_994467662 18 Left 994467659 5:100159002-100159024 CCTCTTTTACTCCAAACAATGAA No data
Right 994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG No data
994467661_994467662 7 Left 994467661 5:100159013-100159035 CCAAACAATGAAAAAAGGATCTT No data
Right 994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994467662 Original CRISPR ATGCCCTTCTAGAATAGTGA AGG Intergenic
No off target data available for this crispr