ID: 994468175

View in Genome Browser
Species Human (GRCh38)
Location 5:100165584-100165606
Sequence CCTAATCTTGCATATTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994468175_994468181 13 Left 994468175 5:100165584-100165606 CCTAGAAAATATGCAAGATTAGG No data
Right 994468181 5:100165620-100165642 ACAGGGCCTCTGCAGTGAAAAGG No data
994468175_994468179 -5 Left 994468175 5:100165584-100165606 CCTAGAAAATATGCAAGATTAGG No data
Right 994468179 5:100165602-100165624 TTAGGATGGAGTATGGAAACAGG No data
994468175_994468180 -4 Left 994468175 5:100165584-100165606 CCTAGAAAATATGCAAGATTAGG No data
Right 994468180 5:100165603-100165625 TAGGATGGAGTATGGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994468175 Original CRISPR CCTAATCTTGCATATTTTCT AGG (reversed) Intergenic
No off target data available for this crispr