ID: 994468181

View in Genome Browser
Species Human (GRCh38)
Location 5:100165620-100165642
Sequence ACAGGGCCTCTGCAGTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994468175_994468181 13 Left 994468175 5:100165584-100165606 CCTAGAAAATATGCAAGATTAGG No data
Right 994468181 5:100165620-100165642 ACAGGGCCTCTGCAGTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994468181 Original CRISPR ACAGGGCCTCTGCAGTGAAA AGG Intergenic
No off target data available for this crispr