ID: 994473414

View in Genome Browser
Species Human (GRCh38)
Location 5:100238433-100238455
Sequence CTGCAGAAGCAGTAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994473411_994473414 12 Left 994473411 5:100238398-100238420 CCTTCATTAGTCTGAGGGGGGAT No data
Right 994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994473414 Original CRISPR CTGCAGAAGCAGTAGCAGAG AGG Intergenic
No off target data available for this crispr