ID: 994473981

View in Genome Browser
Species Human (GRCh38)
Location 5:100244030-100244052
Sequence GGGAACTCGTATACTGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994473980_994473981 -6 Left 994473980 5:100244013-100244035 CCAAGGTACAGAGAAAAGGGAAC No data
Right 994473981 5:100244030-100244052 GGGAACTCGTATACTGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994473981 Original CRISPR GGGAACTCGTATACTGTTGT TGG Intergenic