ID: 994475839

View in Genome Browser
Species Human (GRCh38)
Location 5:100267861-100267883
Sequence TTGGTTAAACAGCTTGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994475836_994475839 -9 Left 994475836 5:100267847-100267869 CCCCAAAACAGAGATTGGTTAAA No data
Right 994475839 5:100267861-100267883 TTGGTTAAACAGCTTGTGCATGG No data
994475837_994475839 -10 Left 994475837 5:100267848-100267870 CCCAAAACAGAGATTGGTTAAAC No data
Right 994475839 5:100267861-100267883 TTGGTTAAACAGCTTGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994475839 Original CRISPR TTGGTTAAACAGCTTGTGCA TGG Intergenic
No off target data available for this crispr