ID: 994477528

View in Genome Browser
Species Human (GRCh38)
Location 5:100290136-100290158
Sequence TGGCATAATCATAATGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994477528_994477534 8 Left 994477528 5:100290136-100290158 CCACCACCATTATGATTATGCCA No data
Right 994477534 5:100290167-100290189 CAGAAGCCAGCACACAGTGCTGG No data
994477528_994477535 9 Left 994477528 5:100290136-100290158 CCACCACCATTATGATTATGCCA No data
Right 994477535 5:100290168-100290190 AGAAGCCAGCACACAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994477528 Original CRISPR TGGCATAATCATAATGGTGG TGG (reversed) Intergenic
No off target data available for this crispr