ID: 994477535

View in Genome Browser
Species Human (GRCh38)
Location 5:100290168-100290190
Sequence AGAAGCCAGCACACAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994477527_994477535 16 Left 994477527 5:100290129-100290151 CCTGTCACCACCACCATTATGAT No data
Right 994477535 5:100290168-100290190 AGAAGCCAGCACACAGTGCTGGG No data
994477528_994477535 9 Left 994477528 5:100290136-100290158 CCACCACCATTATGATTATGCCA No data
Right 994477535 5:100290168-100290190 AGAAGCCAGCACACAGTGCTGGG No data
994477531_994477535 3 Left 994477531 5:100290142-100290164 CCATTATGATTATGCCAGGTTAC No data
Right 994477535 5:100290168-100290190 AGAAGCCAGCACACAGTGCTGGG No data
994477530_994477535 6 Left 994477530 5:100290139-100290161 CCACCATTATGATTATGCCAGGT No data
Right 994477535 5:100290168-100290190 AGAAGCCAGCACACAGTGCTGGG No data
994477526_994477535 17 Left 994477526 5:100290128-100290150 CCCTGTCACCACCACCATTATGA No data
Right 994477535 5:100290168-100290190 AGAAGCCAGCACACAGTGCTGGG No data
994477525_994477535 18 Left 994477525 5:100290127-100290149 CCCCTGTCACCACCACCATTATG No data
Right 994477535 5:100290168-100290190 AGAAGCCAGCACACAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994477535 Original CRISPR AGAAGCCAGCACACAGTGCT GGG Intergenic
No off target data available for this crispr