ID: 994479941

View in Genome Browser
Species Human (GRCh38)
Location 5:100321941-100321963
Sequence CAATTTCAAGACACTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994479941_994479947 30 Left 994479941 5:100321941-100321963 CCAGCAGCAGTGTCTTGAAATTG No data
Right 994479947 5:100321994-100322016 AAGATAAAAGGCTTCTTGAGGGG No data
994479941_994479944 18 Left 994479941 5:100321941-100321963 CCAGCAGCAGTGTCTTGAAATTG No data
Right 994479944 5:100321982-100322004 TAGAGGATGCTTAAGATAAAAGG No data
994479941_994479942 1 Left 994479941 5:100321941-100321963 CCAGCAGCAGTGTCTTGAAATTG No data
Right 994479942 5:100321965-100321987 GAAAACACTACCTATGTTAGAGG No data
994479941_994479946 29 Left 994479941 5:100321941-100321963 CCAGCAGCAGTGTCTTGAAATTG No data
Right 994479946 5:100321993-100322015 TAAGATAAAAGGCTTCTTGAGGG No data
994479941_994479945 28 Left 994479941 5:100321941-100321963 CCAGCAGCAGTGTCTTGAAATTG No data
Right 994479945 5:100321992-100322014 TTAAGATAAAAGGCTTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994479941 Original CRISPR CAATTTCAAGACACTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr