ID: 994480878

View in Genome Browser
Species Human (GRCh38)
Location 5:100333336-100333358
Sequence TCTGAACTCATGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994480878_994480881 -4 Left 994480878 5:100333336-100333358 CCCTCTTCCTTCATGAGTTCAGA No data
Right 994480881 5:100333355-100333377 CAGAACAAAATGAGAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994480878 Original CRISPR TCTGAACTCATGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr