ID: 994486512

View in Genome Browser
Species Human (GRCh38)
Location 5:100390332-100390354
Sequence ATTGAGTAGTAACCCCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994486512_994486520 30 Left 994486512 5:100390332-100390354 CCATGTTGGGGTTACTACTCAAT No data
Right 994486520 5:100390385-100390407 GCCTCAGCCACAGCTGCAGCAGG No data
994486512_994486515 7 Left 994486512 5:100390332-100390354 CCATGTTGGGGTTACTACTCAAT No data
Right 994486515 5:100390362-100390384 ATGCAGGCCCCTCATATTTCTGG No data
994486512_994486516 8 Left 994486512 5:100390332-100390354 CCATGTTGGGGTTACTACTCAAT No data
Right 994486516 5:100390363-100390385 TGCAGGCCCCTCATATTTCTGGG No data
994486512_994486514 -9 Left 994486512 5:100390332-100390354 CCATGTTGGGGTTACTACTCAAT No data
Right 994486514 5:100390346-100390368 CTACTCAATGCAATGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994486512 Original CRISPR ATTGAGTAGTAACCCCAACA TGG (reversed) Intergenic
No off target data available for this crispr