ID: 994486518

View in Genome Browser
Species Human (GRCh38)
Location 5:100390370-100390392
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994486518_994486523 2 Left 994486518 5:100390370-100390392 CCCTCATATTTCTGGGCCTCAGC No data
Right 994486523 5:100390395-100390417 CAGCTGCAGCAGGTGCCCAGAGG No data
994486518_994486520 -8 Left 994486518 5:100390370-100390392 CCCTCATATTTCTGGGCCTCAGC No data
Right 994486520 5:100390385-100390407 GCCTCAGCCACAGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994486518 Original CRISPR GCTGAGGCCCAGAAATATGA GGG (reversed) Intergenic
No off target data available for this crispr