ID: 994486520

View in Genome Browser
Species Human (GRCh38)
Location 5:100390385-100390407
Sequence GCCTCAGCCACAGCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994486517_994486520 -7 Left 994486517 5:100390369-100390391 CCCCTCATATTTCTGGGCCTCAG No data
Right 994486520 5:100390385-100390407 GCCTCAGCCACAGCTGCAGCAGG No data
994486518_994486520 -8 Left 994486518 5:100390370-100390392 CCCTCATATTTCTGGGCCTCAGC No data
Right 994486520 5:100390385-100390407 GCCTCAGCCACAGCTGCAGCAGG No data
994486512_994486520 30 Left 994486512 5:100390332-100390354 CCATGTTGGGGTTACTACTCAAT No data
Right 994486520 5:100390385-100390407 GCCTCAGCCACAGCTGCAGCAGG No data
994486519_994486520 -9 Left 994486519 5:100390371-100390393 CCTCATATTTCTGGGCCTCAGCC No data
Right 994486520 5:100390385-100390407 GCCTCAGCCACAGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994486520 Original CRISPR GCCTCAGCCACAGCTGCAGC AGG Intergenic
No off target data available for this crispr