ID: 994486686

View in Genome Browser
Species Human (GRCh38)
Location 5:100391189-100391211
Sequence GCTGAGGCCCAGAAACATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994486686_994486691 2 Left 994486686 5:100391189-100391211 CCCTCATGTTTCTGGGCCTCAGC No data
Right 994486691 5:100391214-100391236 CAGCTGCAGCAGGTGCCCAGAGG No data
994486686_994486688 -8 Left 994486686 5:100391189-100391211 CCCTCATGTTTCTGGGCCTCAGC No data
Right 994486688 5:100391204-100391226 GCCTCAGCCACAGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994486686 Original CRISPR GCTGAGGCCCAGAAACATGA GGG (reversed) Intergenic
No off target data available for this crispr