ID: 994486855

View in Genome Browser
Species Human (GRCh38)
Location 5:100392008-100392030
Sequence GCTGAGGCCCAGAAATATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994486855_994486857 -8 Left 994486855 5:100392008-100392030 CCCTCATATTTCTGGGCCTCAGC No data
Right 994486857 5:100392023-100392045 GCCTCAGCCACAGCTGCAGCAGG No data
994486855_994486860 2 Left 994486855 5:100392008-100392030 CCCTCATATTTCTGGGCCTCAGC No data
Right 994486860 5:100392033-100392055 CAGCTGCAGCAGGTGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994486855 Original CRISPR GCTGAGGCCCAGAAATATGA GGG (reversed) Intergenic
No off target data available for this crispr