ID: 994488649

View in Genome Browser
Species Human (GRCh38)
Location 5:100412012-100412034
Sequence ACTAATATCCAGAATGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994488649_994488650 -3 Left 994488649 5:100412012-100412034 CCTTGCACATTCTGGATATTAGT No data
Right 994488650 5:100412032-100412054 AGTTCCTGTAAGATATAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994488649 Original CRISPR ACTAATATCCAGAATGTGCA AGG (reversed) Intergenic
No off target data available for this crispr