ID: 994489665

View in Genome Browser
Species Human (GRCh38)
Location 5:100424882-100424904
Sequence TAGGACTTGTTAGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994489662_994489665 3 Left 994489662 5:100424856-100424878 CCTATATAGAGGTGATTAAATCT No data
Right 994489665 5:100424882-100424904 TAGGACTTGTTAGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994489665 Original CRISPR TAGGACTTGTTAGGAAAAAC AGG Intergenic
No off target data available for this crispr