ID: 994490343

View in Genome Browser
Species Human (GRCh38)
Location 5:100434928-100434950
Sequence CTCTAAATAGAGATGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994490343_994490349 -7 Left 994490343 5:100434928-100434950 CCCAGCCCCATCTCTATTTAGAG No data
Right 994490349 5:100434944-100434966 TTTAGAGTTATTTCTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994490343 Original CRISPR CTCTAAATAGAGATGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr