ID: 994490343 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:100434928-100434950 |
| Sequence | CTCTAAATAGAGATGGGGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 994490343_994490349 | -7 | Left | 994490343 | 5:100434928-100434950 | CCCAGCCCCATCTCTATTTAGAG | No data | ||
| Right | 994490349 | 5:100434944-100434966 | TTTAGAGTTATTTCTCTGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 994490343 | Original CRISPR | CTCTAAATAGAGATGGGGCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||