ID: 994496336

View in Genome Browser
Species Human (GRCh38)
Location 5:100517843-100517865
Sequence CTGGATTCCCTGAACCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994496333_994496336 12 Left 994496333 5:100517808-100517830 CCAACAGCTGGAAGACTTGAGAA No data
Right 994496336 5:100517843-100517865 CTGGATTCCCTGAACCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994496336 Original CRISPR CTGGATTCCCTGAACCAGCC TGG Intergenic
No off target data available for this crispr