ID: 994501400

View in Genome Browser
Species Human (GRCh38)
Location 5:100583183-100583205
Sequence TAGGCTGAAGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1358
Summary {0: 1, 1: 4, 2: 32, 3: 173, 4: 1148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994501397_994501400 -5 Left 994501397 5:100583165-100583187 CCTTGTCTTCACGTTGAGTAGGC 0: 6
1: 30
2: 76
3: 79
4: 120
Right 994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG 0: 1
1: 4
2: 32
3: 173
4: 1148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994501400 Original CRISPR TAGGCTGAAGAGAAGGAGGA AGG Intronic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900287514 1:1908748-1908770 GAGGCTGAAGAGGACGCGGACGG + Intergenic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
901116632 1:6850744-6850766 TAGGCAGATGAGAAGCTGGACGG + Intronic
902108026 1:14054031-14054053 TTGGCTGAAGAAGAGCAGGAAGG + Intergenic
902976626 1:20093212-20093234 GAGGAAGAAGAGGAGGAGGAAGG - Intergenic
903125108 1:21242497-21242519 TGGGCTGAACACAAGGAGGAGGG + Intronic
903331723 1:22600093-22600115 GAGGAAGGAGAGAAGGAGGAAGG + Intronic
903410498 1:23139483-23139505 TAGGCTGAGGAGGGAGAGGAAGG - Intronic
903431926 1:23310838-23310860 TAAGAGGAAGAGGAGGAGGAAGG - Exonic
903616745 1:24665074-24665096 TAGGATTTAGAGATGGAGGAAGG + Intronic
904233371 1:29096332-29096354 GAGACAGAAGAGAAGGAGGAGGG + Intronic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904255978 1:29255151-29255173 GGGCCTGAAGAGAGGGAGGAGGG + Intronic
904932429 1:34099938-34099960 TTGGCTGATGAGAAGGTGGAAGG + Intronic
904948233 1:34214819-34214841 GAGGGTGAGGAGAAGGAGCAGGG + Intronic
905052657 1:35065208-35065230 TAGGTTGTGGAGGAGGAGGAAGG - Intronic
905120215 1:35676062-35676084 GAGGAAGAAGAGAGGGAGGAAGG - Intergenic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905943880 1:41885686-41885708 AAGGAGGAAGGGAAGGAGGAAGG - Intronic
905943884 1:41885698-41885720 AAGGAGGAAGGGAAGGAGGAAGG - Intronic
905943888 1:41885710-41885732 GAGGGGGAAGGGAAGGAGGAAGG - Intronic
906037227 1:42758815-42758837 TAGCCAGCAGAGAAAGAGGAAGG + Intronic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
906288872 1:44606368-44606390 TAGTTTTAAGAGAAGGAGGAAGG + Intronic
906306607 1:44723947-44723969 TCAGTTGAAGAGCAGGAGGAGGG - Intronic
906493370 1:46285577-46285599 GTGGCTGGCGAGAAGGAGGATGG - Exonic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907038192 1:51235402-51235424 TAGCCTGATGAGAAGCAGAAAGG + Intergenic
907053073 1:51342833-51342855 CAGGCTGAGGAGAAGGTGTAGGG - Intronic
907228157 1:52969059-52969081 TAGGCTGAGGAGGAAGGGGAAGG + Intronic
907839820 1:58145932-58145954 GAGGCTGAGGAGAAGGAGGAGGG - Intronic
907921106 1:58912683-58912705 TAGGCTGAAGGGGAGGTAGAAGG - Intergenic
908134412 1:61115480-61115502 TGAGCTGGAGAGAATGAGGATGG + Intronic
908378092 1:63566346-63566368 GAGGGTGAAGAGTACGAGGAGGG + Intronic
908567119 1:65368684-65368706 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
908792703 1:67798582-67798604 TAGGCTGAGGAGAAGGAGGAAGG - Intronic
909142555 1:71887229-71887251 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
910315610 1:85879765-85879787 TAGGCTGAGGAGGTGGAAGAAGG + Intronic
910705186 1:90122206-90122228 CAAGCTGAAGAAAAGGAGCAAGG - Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
910964445 1:92794171-92794193 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
911043079 1:93607399-93607421 AGGCCTGAAGAGAAGGTGGAGGG + Intronic
911076615 1:93881716-93881738 TAAGCTGAGGAGGAAGAGGAGGG - Intergenic
911930490 1:103896684-103896706 TAAGCTGAAGAGGAGGAGGCAGG - Intergenic
912190011 1:107327100-107327122 TAAGCTGAAGAGAAGCAGCTGGG + Intronic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
912953312 1:114135472-114135494 TAGGAGGAGGAGATGGAGGAGGG + Intronic
913373794 1:118129647-118129669 AAGAAGGAAGAGAAGGAGGATGG - Intronic
913601045 1:120421427-120421449 AAGGCAGAAGGGAAGGAGGGAGG - Intergenic
914086008 1:144455202-144455224 AAGGCAGAAGGGAAGGAGGGAGG + Intronic
914489441 1:148142087-148142109 AAGGCAGAAGGGAAGGAGGGAGG + Intronic
914686117 1:149981098-149981120 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
915195586 1:154186930-154186952 TAAGCAGTAGAGAAGGAGGAGGG - Intronic
915246392 1:154558756-154558778 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
915824779 1:159063868-159063890 TAGACTGAGGAGGAAGAGGAGGG - Intronic
915935556 1:160088374-160088396 CAAGCTGAAGTGAAGGAGAAAGG + Exonic
916025046 1:160826250-160826272 TAGGCTGAGGAGGAAGAGGAAGG + Intronic
916881241 1:169021492-169021514 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
917962131 1:180154124-180154146 TAGGCTGAAGAGCTGGATGTGGG + Intergenic
918002924 1:180514566-180514588 GAGGAAGAAGAGGAGGAGGAGGG + Intergenic
918581201 1:186132136-186132158 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
918586357 1:186193255-186193277 GAGGGAGAAGGGAAGGAGGAAGG + Intergenic
918666663 1:187159624-187159646 TATACTGAAGAGCAGGAGGTAGG - Intergenic
918786066 1:188765535-188765557 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
919263452 1:195229889-195229911 TTGGAAGAAGAGAAGGTGGAAGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919426343 1:197436350-197436372 TAGGATGAAGAGGAAGAGAAGGG + Intronic
919538339 1:198816245-198816267 TAGGCTAAGGAGAAGTAGAAAGG - Intergenic
919626976 1:199920676-199920698 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
919801948 1:201359500-201359522 TGGGCTGAAGCAGAGGAGGAAGG + Intronic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920034663 1:203058195-203058217 CTGGCTGAGGAGGAGGAGGAGGG + Intronic
920070774 1:203301481-203301503 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
920894163 1:210027514-210027536 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
920986149 1:210891390-210891412 TGGGGTGAGGAGAAGGGGGAGGG + Intronic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921165290 1:212502562-212502584 AAGGGTGAGGAGAAGAAGGAGGG + Intergenic
921298821 1:213729915-213729937 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921886370 1:220310887-220310909 TAGGCAGGAGAAAAGGAGAATGG - Intergenic
921948679 1:220906880-220906902 TGGGCTGAATTTAAGGAGGAGGG + Intergenic
922187975 1:223293206-223293228 TAGGGGTAAGAGGAGGAGGAAGG - Intronic
922191343 1:223321226-223321248 AATGCTGAAGAAAAGCAGGAAGG - Intronic
922213488 1:223502640-223502662 TAGGCGGACGAAAAGGAGGAAGG + Intergenic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
922723853 1:227913607-227913629 AAGGCTGAGGAGGAGGAGGGAGG + Intergenic
922819279 1:228472837-228472859 GAGGCTGCAGAGGAGGAGGAAGG - Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
922986302 1:229868515-229868537 TAGGCTGAGGAGGAGGAAGGAGG - Intergenic
923290770 1:232543439-232543461 TAGGCAGAAGAGGAAGAGAAAGG - Intronic
923296777 1:232602116-232602138 AAGACTGAAGACAAGGAGGTGGG + Intergenic
923314059 1:232762302-232762324 TAGGCTGAGGAAGAGGAAGAAGG - Intergenic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
924226313 1:241924580-241924602 TAGGCTGAGGAGGAAGAGGAAGG - Intergenic
924315520 1:242791446-242791468 TAGACTGAAGAGAAAGAGATGGG + Intergenic
924413181 1:243828536-243828558 TAGGCTGAGGAGGAAGAGAAAGG - Intronic
924585830 1:245360312-245360334 TGGGATGAGGATAAGGAGGATGG - Intronic
924948439 1:248861665-248861687 TAGGCTGCAGAGGAGAAGGCTGG - Intergenic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063227870 10:4033374-4033396 GATGCTGAAGAGAAGGAGGTGGG - Intergenic
1063245306 10:4211736-4211758 TGGGCCGAGGAGGAGGAGGAAGG + Intergenic
1063345418 10:5307394-5307416 TAGGCTGAAGCTCAGGAGCAGGG + Intergenic
1063494626 10:6495427-6495449 TTAGGTGAAGAGCAGGAGGAAGG - Intronic
1063525273 10:6778937-6778959 AAGGAAGAAGAGAGGGAGGAAGG + Intergenic
1063594648 10:7423107-7423129 GAAGCAGAAGAAAAGGAGGAGGG + Intergenic
1063907041 10:10791947-10791969 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
1064121741 10:12624958-12624980 AAGGAGGAAGAGAAGGAGAAGGG - Intronic
1064741541 10:18439792-18439814 TAGGCAGAAGGGAGGGAGGGAGG - Intronic
1064850824 10:19706968-19706990 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
1065023003 10:21516537-21516559 GAGGAGGAAGAGGAGGAGGAGGG - Exonic
1065309251 10:24398316-24398338 AAAGCTGAAGAAGAGGAGGAGGG + Intronic
1065578539 10:27148530-27148552 TGGGCTGAGGAGGAAGAGGAGGG - Intronic
1065739080 10:28780597-28780619 TAGGCTGAGGAGGAAGAGGAGGG + Intergenic
1065846878 10:29751829-29751851 TAGGGTGATGAGAGGGAGAATGG + Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1066753367 10:38683435-38683457 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1066997630 10:42578360-42578382 GAGGATGAAGAGGAGGAGTAGGG - Intronic
1067310715 10:45111187-45111209 TGGGCTGAGGAGGAAGAGGAGGG - Intergenic
1067342426 10:45416715-45416737 ATGGATGAAGGGAAGGAGGAAGG + Intronic
1067348565 10:45455845-45455867 TAGGCAGAAAAGAAGGGAGAGGG + Exonic
1068331450 10:55576358-55576380 CAGGCTGAGGAGAAAGAGGAAGG + Intronic
1068435753 10:56989070-56989092 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1068744415 10:60513985-60514007 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
1068913408 10:62403304-62403326 GAGGAGGAAGAGGAGGAGGAAGG + Intronic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069668752 10:70183785-70183807 AAGGCTGAAGAGGATGTGGATGG - Intergenic
1070054164 10:72918553-72918575 TAGGTGGGAGAGAAGGCGGATGG + Intronic
1070085143 10:73229771-73229793 CATTCTGAAGAGAAAGAGGAAGG + Intronic
1070100474 10:73381343-73381365 TAGGAAGAAAGGAAGGAGGAAGG + Intronic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070737196 10:78871322-78871344 TAGAATGAAGAGAATGAGCAGGG - Intergenic
1071106333 10:82100364-82100386 AAGGCTGAAAAAAAGGAAGAGGG - Intronic
1071201738 10:83227182-83227204 TAGGTTGTAGAGAAAGAGGCAGG - Intergenic
1071203811 10:83251727-83251749 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1071382177 10:85077372-85077394 TGGGTTGAGGAGAAGGGGGAGGG + Intergenic
1071388925 10:85150379-85150401 TAGGAAAAAGAGGAGGAGGAAGG - Intergenic
1071489368 10:86125681-86125703 GAGGCGGGAGAGATGGAGGAGGG - Intronic
1071489381 10:86125731-86125753 TAGGCTGAGGAAGAGGCGGAAGG - Intronic
1071867757 10:89755494-89755516 CAGGATGAAGAAAAGGAAGAAGG - Intronic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072642053 10:97219093-97219115 TAGGTTGAGGAGGAAGAGGAGGG - Intronic
1073078883 10:100844107-100844129 TAGGCTGAGGAGAAGGAGGGAGG - Intergenic
1073103288 10:101018334-101018356 TGGGCAGAAGGGAAGGACGAGGG + Intronic
1073220517 10:101868577-101868599 TAGGCTGAGGAGGAGGAAGGAGG - Intronic
1073328540 10:102656552-102656574 TAAGCTGAAGAAATGGAGGCTGG - Intronic
1073462057 10:103671570-103671592 TGGGCTAGAGAGAAGGGGGAGGG - Intronic
1073527108 10:104193971-104193993 ACGGCTGCAGAGAGGGAGGATGG + Exonic
1073547196 10:104360624-104360646 GAGGGTGAAGAGTAGGAGGAGGG - Intronic
1073597728 10:104817419-104817441 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1073915019 10:108392660-108392682 TAGGCTGAAGAGAGGGACAAGGG + Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1073991702 10:109268811-109268833 TAGCCTGAGGAGTGGGAGGATGG + Intergenic
1074020975 10:109582419-109582441 TAGGCTGAAGAGAAAAAGGAGGG + Intergenic
1074064182 10:109998151-109998173 TACTCTGAAGAGAAGAAAGAGGG + Intronic
1074107193 10:110397343-110397365 TAGGCTGAGGAGGAAGAGGAGGG + Intergenic
1074944124 10:118264704-118264726 TAGCAGGAAGAGAAGGAGCAGGG + Intergenic
1075045742 10:119145193-119145215 TAGGCTGCGGAGGAGGAAGAGGG - Intronic
1075065627 10:119287255-119287277 GAGGAGGAAGGGAAGGAGGAAGG + Intronic
1075065651 10:119287338-119287360 GAGGAGGAAGGGAAGGAGGAAGG + Intronic
1075212405 10:120502345-120502367 AAGGGGGAAGAGAAGGAGGGAGG + Intronic
1075544294 10:123342870-123342892 GAGGCTGGAAAGAAGGAGGCAGG + Intergenic
1075762539 10:124867470-124867492 TAGGTGGTAGAGAAGGCGGACGG - Intergenic
1075814324 10:125253243-125253265 TTGGATGAAGGGAGGGAGGAAGG - Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076493610 10:130881783-130881805 AAGGGTGAAGACAAGCAGGAAGG - Intergenic
1076980931 11:204328-204350 GAGGCTGGGGACAAGGAGGATGG + Exonic
1077010468 11:377047-377069 GAGGGCGAAGAGGAGGAGGAAGG + Exonic
1077174154 11:1181120-1181142 AAGGCTGGAGACAAGGAAGAAGG - Intronic
1077261128 11:1621642-1621664 CAGCCTGAAGAGAAGCAGCAGGG + Exonic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1078135799 11:8650462-8650484 AAGGAGGAAGGGAAGGAGGAAGG + Intronic
1078156640 11:8805627-8805649 TAGGCTGGGAAAAAGGAGGAGGG - Intronic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078386578 11:10898355-10898377 AGGGCTGGAGAGGAGGAGGAGGG + Intergenic
1078836140 11:15031877-15031899 TAGGCTGAGGAGGAGGAGGAAGG - Intronic
1078885622 11:15497101-15497123 TGGGCTGAAGAGAAGTGAGAGGG + Intergenic
1079115279 11:17636660-17636682 AAGACAGAAGAGAAGGAGAAAGG - Intronic
1079266558 11:18938717-18938739 TAGGCTGAAAGGGAGAAGGAAGG - Intronic
1079289179 11:19171444-19171466 TAACAAGAAGAGAAGGAGGAAGG + Intronic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1079973292 11:27062252-27062274 TAGGCAACAGAGAAGAAGGAAGG + Intronic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080073335 11:28115724-28115746 TAGACTGAGGAAGAGGAGGAGGG + Intronic
1080106109 11:28512961-28512983 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1080187619 11:29509099-29509121 AATACTGAAGAGAAAGAGGATGG + Intergenic
1080727014 11:34908532-34908554 TTGACTGATGAGGAGGAGGAGGG - Intronic
1080944632 11:36957886-36957908 TAGGGTGAAGAGGAGAAAGATGG + Intergenic
1081156094 11:39692921-39692943 TAGGCTGAGGAGGAAGAGAAGGG - Intergenic
1081409130 11:42735022-42735044 GAGGGAGGAGAGAAGGAGGAGGG + Intergenic
1082044908 11:47717436-47717458 AAGGCTGAAGAGAAGGAAAATGG - Exonic
1082101753 11:48178576-48178598 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1082234090 11:49801441-49801463 TAGGCTGATGGGGAAGAGGAAGG - Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1084441847 11:69179098-69179120 TGGGCAGAAGAGAAGGAAGGAGG + Intergenic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084592282 11:70097691-70097713 AAGGTTGGAGAGAAGGCGGATGG + Intronic
1084769602 11:71334226-71334248 TAGGCCCAGGAGAAGGAGGGAGG + Intergenic
1084859528 11:72009217-72009239 GAGGTTGAAGGGCAGGAGGAAGG + Intronic
1085027719 11:73246708-73246730 TAGGCTGAGGAAAAGGTGGAAGG - Intergenic
1085064758 11:73484081-73484103 TTGACTGAAGATAAGGAGGGAGG - Intronic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1085824301 11:79827276-79827298 TAGGCTGGATAGAGGGAGCATGG + Intergenic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086291707 11:85317757-85317779 GAGGATGAAGGGTAGGAGGAGGG + Intronic
1086314705 11:85579232-85579254 AAGGGTGAAGGGTAGGAGGAGGG + Intronic
1086617501 11:88840003-88840025 TAGGCTGATGGGGAAGAGGAAGG + Intronic
1086906380 11:92422695-92422717 AAGGCTGAAAAGAAGGCTGAAGG + Intronic
1087140776 11:94763759-94763781 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1087296001 11:96374753-96374775 GAGGGTGGAGAGTAGGAGGAGGG - Intronic
1087474858 11:98622232-98622254 TGGGAGGAAGAGAGGGAGGAGGG - Intergenic
1087617631 11:100506586-100506608 GAGGCTGAAGAGGAGGTGAAGGG - Intergenic
1088015264 11:105050722-105050744 TAAGCTGAAGAGATGGAGGAAGG + Intronic
1088508291 11:110548360-110548382 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1088664078 11:112076682-112076704 TAGGCTGAGGAGGAAGAAGAGGG + Intronic
1088937515 11:114418063-114418085 GAGGCAGAAGAGAAGCAGCAAGG - Intronic
1089743797 11:120603049-120603071 AAGGTAGGAGAGAAGGAGGAAGG + Intronic
1090028605 11:123188405-123188427 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
1090029445 11:123194914-123194936 TAGCAAGAGGAGAAGGAGGAGGG + Exonic
1090092979 11:123715743-123715765 TAAGCTGAGGAGAAGGAACAAGG - Intergenic
1090387021 11:126363293-126363315 GAGGCAGAAAGGAAGGAGGAGGG - Intronic
1090516274 11:127431054-127431076 GAGGCTGCAGAGAAAAAGGAAGG - Intergenic
1090517611 11:127445834-127445856 TCGGCTGGAGAGGAGCAGGATGG - Intergenic
1090602596 11:128388641-128388663 TAGGCTGAATAGATAGGGGAAGG - Intergenic
1090640551 11:128725943-128725965 AAGGCAGAAGAGAAGCCGGAGGG + Intronic
1090855581 11:130607319-130607341 AAGGCTGAGGAGGAGGTGGAGGG + Intergenic
1090880302 11:130826860-130826882 TAGCCTGGAGAGAAGCAGGCTGG + Intergenic
1090976852 11:131686567-131686589 GAGGCAGAAGAGGAGGAGGCAGG + Intronic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1091458241 12:624127-624149 TAGGTTGTAGAGTAAGAGGATGG - Intronic
1091632810 12:2174956-2174978 TAGGAAGAGGAGGAGGAGGAGGG + Intronic
1091663748 12:2403695-2403717 TGGACTGGAGAGATGGAGGAGGG - Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1092126840 12:6080532-6080554 TAGGCTGCAGGGCAGGAGGGAGG + Intronic
1092240009 12:6830494-6830516 GGGGCTGAAGAAGAGGAGGATGG + Exonic
1092279172 12:7086616-7086638 TGGGCTGGGGAGAAGGAAGAAGG - Intronic
1092986613 12:13851925-13851947 TAGGCAGAGGAGGAGGAGGGTGG + Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093654151 12:21675702-21675724 TAGGAGGAAGAGAAGGAGGAGGG - Intronic
1093990934 12:25589779-25589801 TAGGCTGAAGAGAGTGTAGATGG + Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1095947711 12:47763298-47763320 TGGGATGGAGAGAGGGAGGATGG + Intronic
1095970047 12:47895394-47895416 TGGGAGGGAGAGAAGGAGGAGGG + Intronic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096594999 12:52689433-52689455 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1096785155 12:54013107-54013129 AAGGCTGAGGAGGAGGAGGGTGG - Intronic
1097193836 12:57233130-57233152 TAAGCTGAAAAGAAGGACAAGGG - Intronic
1097210231 12:57362251-57362273 TAGGCTGAAGAGGAAGAAGAGGG - Intronic
1097504199 12:60444012-60444034 TAGGTGGAAGAGTAGAAGGATGG + Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097832127 12:64236371-64236393 GAGGAAGAAGAGGAGGAGGAAGG + Intergenic
1098005671 12:65994535-65994557 TAACCTGAGGAGGAGGAGGAGGG - Intergenic
1098512896 12:71339794-71339816 GAGCGGGAAGAGAAGGAGGAGGG + Intronic
1098701321 12:73631222-73631244 GAGGTGGAAGAGAAGGAGGAGGG + Intergenic
1098762624 12:74444352-74444374 TAAACTGAAGAAAAGGAAGAAGG - Intergenic
1099288019 12:80739447-80739469 TAGGCTGAAGGGGAGGAGAAGGG + Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100908314 12:99328228-99328250 TAGGCTGTAGTGCAGGAGAAGGG + Intronic
1101497638 12:105270515-105270537 TAGGAAGGTGAGAAGGAGGAAGG + Intronic
1101703752 12:107200412-107200434 GAGGCTGAAGTGCAGGAGGATGG - Intergenic
1102295523 12:111733669-111733691 AAGGCTGCAGAGAAGGAGCTGGG + Intronic
1102429072 12:112867618-112867640 AAGGCTGAAGAGATAGAGGAGGG + Intronic
1102641951 12:114374584-114374606 TCTGGTGAAGAGAAGGAGGCAGG + Intronic
1102737864 12:115179170-115179192 AAGGGAGAAGGGAAGGAGGAGGG + Intergenic
1102764721 12:115422918-115422940 AAGGGAGGAGAGAAGGAGGAAGG + Intergenic
1103059539 12:117847621-117847643 TAGGCTGAACAGAAGGTGTCTGG - Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1103743346 12:123106107-123106129 TGGGGTGAAGAGAAGAAGCAGGG - Intronic
1103896677 12:124277903-124277925 GAGGCAGAAGAGGAGGAAGAGGG - Intronic
1103954356 12:124567936-124567958 GGGGCTGGAGAGGAGGAGGAGGG - Intergenic
1104091454 12:125521215-125521237 GAAGAGGAAGAGAAGGAGGAAGG - Intronic
1104163620 12:126204953-126204975 TTGGCTGATAAGAAGGAGAAAGG - Intergenic
1104417231 12:128605667-128605689 TCGGCTGAGGAGAAGGAAGTGGG + Intronic
1104896546 12:132167702-132167724 GAGGCTGCAGAGAGGGAGGGTGG - Intergenic
1105303919 13:19156290-19156312 CAGGATGAAGAGCAGGTGGAAGG - Intergenic
1105409809 13:20161686-20161708 GTGTCTGAAGAGAAGCAGGATGG - Intergenic
1105597694 13:21854886-21854908 AAGGAGGAAGAGAAGGAAGAAGG - Intergenic
1105633485 13:22195011-22195033 TAAGCCAAAGATAAGGAGGAAGG + Intergenic
1105933626 13:25076749-25076771 TAGTCTGAGGAGGAGAAGGAGGG + Intergenic
1106192602 13:27466744-27466766 GAAGCTGATGAGAAGGAGGGTGG + Intergenic
1106625462 13:31416640-31416662 TAGGTAGAAGAGGAGGAGGAGGG - Intergenic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107061374 13:36163055-36163077 TAGGCTGCAGAGAGGGAAGGTGG + Intergenic
1107135922 13:36944071-36944093 TTGGCTGAGGAGTAAGAGGAGGG + Intergenic
1107374854 13:39792547-39792569 TAGGCTGAGGAGGAGGAGAAAGG + Intergenic
1107533764 13:41308866-41308888 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1107950103 13:45453829-45453851 GAGGCTGAAGCCAAAGAGGAAGG - Intergenic
1107966526 13:45603033-45603055 GAGGCTTAAGACATGGAGGAGGG + Intronic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108231368 13:48345881-48345903 TATTCTGGAGAGAATGAGGATGG + Intronic
1108450469 13:50557571-50557593 TAGGTTGAAGAGAAAGATGAGGG - Intronic
1108698944 13:52927307-52927329 AAGGAGGAAGAAAAGGAGGAAGG - Intergenic
1108710986 13:53032052-53032074 TGGGCTGATGATAAGCAGGATGG + Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1108928808 13:55788907-55788929 AAGGAAGAAGAGAAGGAGAAAGG - Intergenic
1109299214 13:60573675-60573697 TATTCTGAAGAGAAAGTGGAAGG - Exonic
1109338146 13:61019078-61019100 TAGGCTGAGGGGCAGGAAGAAGG + Intergenic
1110731942 13:78888682-78888704 TAGGATGAAGGAAAGGCGGAGGG + Intergenic
1111364596 13:87225184-87225206 TAGGCTGTGGAGAAATAGGAAGG - Intergenic
1111435143 13:88196829-88196851 GAGGTTGAAGAGTGGGAGGAGGG - Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1111623145 13:90749609-90749631 TAGTGTGAAGAAAATGAGGAGGG - Intergenic
1111856437 13:93643482-93643504 TAGGCTGAACAGAGGTAGGCAGG + Intronic
1111956121 13:94760478-94760500 AAAGAGGAAGAGAAGGAGGAAGG - Intergenic
1111988917 13:95095534-95095556 TAGGGGGAAGAGTGGGAGGAGGG + Intronic
1112301845 13:98238268-98238290 TGGGCTGAGGAGGAAGAGGAGGG - Intronic
1112406965 13:99129818-99129840 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1112446772 13:99471644-99471666 TAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1112682441 13:101782529-101782551 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1113095725 13:106661938-106661960 TGGGAAGAAGAGAAGGAGGTGGG - Intergenic
1113206025 13:107917028-107917050 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224851 13:108147991-108148013 TTGGCTGAATAGATGGAGGTTGG - Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113695032 13:112339238-112339260 AGGACTGAAGAGAAGGAGGGAGG - Intergenic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114220176 14:20689341-20689363 CAGGTTGAAGGGAAGAAGGAAGG + Intronic
1114367969 14:22050597-22050619 TAGGAGGAAGAGAGAGAGGACGG + Intergenic
1114473504 14:22979472-22979494 AAGGCTGAAGCCAAGGAAGAGGG + Intronic
1114495369 14:23128134-23128156 CAGGCTGAAGACCAGCAGGAAGG + Exonic
1114562187 14:23601367-23601389 TAGAGTGAAGAGAGGGAGGCTGG - Intergenic
1114674641 14:24432018-24432040 TACGCTGTGGAGAAGGAGGGAGG + Exonic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1114972865 14:28056132-28056154 TGGGCTGAGGGGAGGGAGGAGGG - Intergenic
1115214108 14:30997559-30997581 GAGGCTGAAGACAGGAAGGAGGG - Intronic
1115401558 14:32967141-32967163 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
1115613638 14:35072401-35072423 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1115971335 14:38948195-38948217 TAGGCTGAAGAGGAAGAGAAGGG + Intergenic
1116132187 14:40869264-40869286 TAGGCTGAGGACGAAGAGGAAGG - Intergenic
1116345607 14:43789501-43789523 TAGGAAGAAGAGAAGAAGTATGG + Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116575370 14:46567798-46567820 AAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1116699713 14:48224534-48224556 TAAGTTGAAGAGCAGAAGGAAGG + Intergenic
1116720838 14:48493556-48493578 TAGGGTGAAGGGTGGGAGGAAGG + Intergenic
1116722857 14:48523071-48523093 TGGGCTGAGGAGGAAGAGGAGGG + Intergenic
1116905621 14:50400799-50400821 TAGCCTAAAAAAAAGGAGGAAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117193465 14:53316640-53316662 TGGGCTGACGAGGAGGAGCAAGG - Intergenic
1117284504 14:54273887-54273909 TGGGGTGAGGAGAAGGGGGAGGG - Intergenic
1117648918 14:57882101-57882123 TGGGCTGATGAGAGGGAGGGAGG - Intronic
1117667299 14:58070017-58070039 CTGGCTGAAGGCAAGGAGGATGG + Intronic
1118073398 14:62271120-62271142 GAGGATGGAGAGAGGGAGGATGG - Intergenic
1118346009 14:64941438-64941460 TAGGCTGAAGAGATGGTGTGAGG + Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118635733 14:67747420-67747442 GAGACTGAAGGGAAGCAGGAGGG + Exonic
1118839072 14:69497550-69497572 CTGGCTGAAGAGAAAGAGGGAGG + Intronic
1118851022 14:69583642-69583664 CAGGCAGAAGAGAGGGAGCAGGG - Intergenic
1118979118 14:70701768-70701790 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119219214 14:72893021-72893043 AAGGATGAAAAGGAGGAGGAAGG + Intronic
1119438666 14:74613548-74613570 TAGGCTGTAGGGAGGGAGCATGG - Intergenic
1119585729 14:75833073-75833095 TTGGCTGAGGAGAATGATGAAGG - Intronic
1119712025 14:76829250-76829272 CAGGCAGCAGAGATGGAGGAAGG + Intronic
1119769594 14:77212108-77212130 TAAGCTGAGGAGGAGGAGGATGG + Intronic
1120336101 14:83157065-83157087 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1120396331 14:83971439-83971461 TAGGTTGAAAAGAAGGAGGAAGG + Intergenic
1120403191 14:84059263-84059285 TCATCTGATGAGAAGGAGGAAGG - Intergenic
1120521194 14:85530081-85530103 TAGGAGGGAGAGGAGGAGGAGGG + Intergenic
1121460871 14:94076925-94076947 TAGGCTGAGTAGAAAGAGGAGGG - Intronic
1121665808 14:95671232-95671254 TGGGCTGGAGTGATGGAGGAGGG - Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122932074 14:104938208-104938230 TCCCCTGAAGAGAAGGAAGAGGG - Exonic
1123107064 14:105846596-105846618 AAGGGAGAAGGGAAGGAGGATGG - Intergenic
1123216233 14:106811743-106811765 TTGGCAGAAGGGAAGGAGAAAGG - Intergenic
1123677820 15:22729218-22729240 TAGGCTGAGGAAGAGGAGGAAGG + Intergenic
1124330021 15:28803482-28803504 TAGGCTGAAGAAGAGGAGGAAGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124828646 15:33126230-33126252 TAGACTTCAGAGAAGGAAGATGG + Intronic
1124993852 15:34703495-34703517 GAAGAAGAAGAGAAGGAGGAGGG - Intergenic
1125037969 15:35149084-35149106 TAGGCTGAAGGGAAAGAGCAAGG - Intergenic
1125121233 15:36161147-36161169 AAGACTGAAGGGAAGAAGGAAGG + Intergenic
1125165694 15:36702126-36702148 TAGGCTGAAGGGAATGGAGATGG + Intronic
1126120166 15:45244506-45244528 TAGGCTGAGGAGGAGAAGGAAGG + Intergenic
1126380184 15:48038571-48038593 CAGGCTGAAGGAAAGGAGTAAGG + Intergenic
1126937799 15:53730631-53730653 TAGGAAGAAGAGAAGGAAGTCGG - Intronic
1127022858 15:54769426-54769448 GAGGGTGGAGGGAAGGAGGAGGG + Intergenic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128454551 15:67825366-67825388 GGGGGTGAAGAGAAGGAGGGGGG - Intronic
1128573859 15:68756146-68756168 TATGCTAAGGTGAAGGAGGAAGG + Intergenic
1128762374 15:70226113-70226135 TAGGTAGACAAGAAGGAGGAGGG + Intergenic
1129065461 15:72900282-72900304 TAGGTGGGAGAGAAGGTGGATGG + Intergenic
1129626273 15:77203196-77203218 CAGGCAGAAGAGGAGGTGGAAGG + Intronic
1129743317 15:78000837-78000859 TAGATTGAAGAGAGGGAGGGAGG - Intronic
1130042544 15:80417531-80417553 GAGAAGGAAGAGAAGGAGGAGGG - Intronic
1130672116 15:85921848-85921870 TTGGCGGAAGAGTAGGAGGGGGG + Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1131901108 15:97088671-97088693 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1131901118 15:97088709-97088731 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1132023273 15:98383013-98383035 TGGGCAGATGCGAAGGAGGAGGG - Intergenic
1132425369 15:101711475-101711497 TAGGCTGATGAGGAAGTGGAAGG - Intronic
1132647310 16:1004997-1005019 GAGGGAGAAGAGAAGGGGGAGGG + Intergenic
1133617849 16:7495448-7495470 GAGGCTGCAGAGAAAAAGGATGG - Intronic
1133645981 16:7765051-7765073 TAGGCTAAAGAGAGGTAGAATGG + Intergenic
1133712229 16:8412319-8412341 TAGGGGGAAGAGTAGGAGGGAGG + Intergenic
1133882363 16:9794928-9794950 AAGGATGAAGAGGAGGAGGAGGG + Intronic
1134064522 16:11219220-11219242 GAGGCTGAAGAGTGAGAGGAAGG - Intergenic
1134073228 16:11273417-11273439 GAGGAGGAAGAGGAGGAGGAGGG - Exonic
1134288001 16:12879208-12879230 AAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1134318918 16:13144895-13144917 TAGGCAAGAGAGAAGGAGGGAGG + Intronic
1134331086 16:13251702-13251724 TATCCTAAAGAAAAGGAGGAGGG - Intergenic
1134405687 16:13956627-13956649 GAGGATGAAGAAAACGAGGATGG + Intergenic
1134649585 16:15898158-15898180 GAGGTTGAGGAGGAGGAGGAGGG - Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1134745965 16:16588590-16588612 TAGACTGAAGAGCAGAAAGAGGG - Intergenic
1134819915 16:17238657-17238679 GATGCTGAAGACAAAGAGGAGGG - Intronic
1134999512 16:18765151-18765173 TAGACTGAAGAGCAGAAAGAGGG + Intergenic
1135532099 16:23263614-23263636 AAGGCTGAAGAGGAAGAGGAGGG - Intergenic
1135547988 16:23378558-23378580 TTGGATGAGGAGCAGGAGGAAGG - Intronic
1135834350 16:25811288-25811310 TAGGCTGAGGAAGAGGAGGAAGG - Intronic
1135925394 16:26689507-26689529 TTGGCTGGGGAGAAGAAGGATGG + Intergenic
1135938744 16:26803019-26803041 AAGGAAGAAGAGAAGGAGGAAGG + Intergenic
1136366555 16:29811818-29811840 GAGGCTGCAGAGGAGGAGCAGGG - Intronic
1136498514 16:30658448-30658470 TAGGCTGAGGAGGAAGAGGGAGG + Exonic
1136532887 16:30881782-30881804 AAGGCTGAAGAAAAGCTGGAAGG - Intronic
1136602168 16:31299790-31299812 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1136729340 16:32393556-32393578 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
1136873157 16:33826333-33826355 TTGGCAGAAGGGAAGGAGAAAGG + Intergenic
1136932336 16:34430646-34430668 TGGGGGGAAGAGAGGGAGGAAGG - Intergenic
1136972236 16:34981168-34981190 TGGGGGGAAGAGAGGGAGGAAGG + Intergenic
1137250835 16:46739549-46739571 TAGGCTGAGGAGGATGAGGAAGG - Intronic
1137257536 16:46789471-46789493 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1137858122 16:51817341-51817363 GAGGATGGAGGGAAGGAGGATGG - Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138299262 16:55912612-55912634 GAGGAGGAAGAGAAGGAGCAGGG + Intronic
1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG + Intergenic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139518669 16:67466939-67466961 AAGGCTGAAGAGGACGTGGAGGG + Intronic
1139649911 16:68357028-68357050 TAGGAAGAAGAGCAGGAAGATGG - Intronic
1139802589 16:69535620-69535642 TAGGATAGAGGGAAGGAGGAGGG + Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139946339 16:70644944-70644966 AAGGAGGAAGAGGAGGAGGAAGG + Intronic
1140102871 16:71933518-71933540 TAAACTGAACAGAAGGAGAAAGG + Exonic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1140959654 16:79899802-79899824 AAGGGAGAAGAGAAAGAGGAGGG - Intergenic
1141056851 16:80824811-80824833 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141490194 16:84367688-84367710 GATGATGAAGAGGAGGAGGATGG + Intergenic
1141597801 16:85107944-85107966 CAGCCTGCAGAAAAGGAGGAGGG + Exonic
1141703599 16:85653236-85653258 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
1142155814 16:88532463-88532485 AAGGCGGAGGAGGAGGAGGAGGG + Intronic
1142340204 16:89517020-89517042 TGGGCTGAGGAGGAGGACGAGGG + Intronic
1202997056 16_KI270728v1_random:123965-123987 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1203023743 16_KI270728v1_random:436307-436329 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1203099015 16_KI270728v1_random:1289722-1289744 TTGGCAGAAGGGAAGGAGAAAGG - Intergenic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143391340 17:6561002-6561024 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1143391355 17:6561063-6561085 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143391424 17:6561269-6561291 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1143991162 17:10963443-10963465 GGGGCTGGAGAGAAGGAGCATGG + Intergenic
1144183345 17:12772924-12772946 GAGGCAGGAGAGAAAGAGGAGGG + Intergenic
1144224567 17:13132318-13132340 TATGCTGATGAGAAGAAAGAGGG + Intergenic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144592052 17:16532615-16532637 TAAGCGGAAAAGAATGAGGAAGG + Intergenic
1145090344 17:19980576-19980598 TTAGCTGGAGAGAATGAGGAAGG - Intergenic
1145279715 17:21458313-21458335 GAGGCTGAAGGAAAGGGGGAGGG + Intergenic
1145302471 17:21650332-21650354 TATGCTGAGGAGGAGGATGATGG + Intergenic
1145398165 17:22512169-22512191 GAGGCTGAAGGAAAGGGGGAGGG - Intergenic
1145857605 17:28177124-28177146 TAGGCTGAGGAGGAAGAGAAAGG + Intronic
1145935594 17:28712905-28712927 CAGGATGAAGAGGAGGAGAAAGG + Intergenic
1145973786 17:28972518-28972540 TGGGCTGAAGAGAAGGCTCAAGG + Intronic
1146399631 17:32492963-32492985 AAGGCTGGAGGGCAGGAGGAGGG - Exonic
1146411278 17:32587748-32587770 GAGGCTGAAGAGCAGAGGGAGGG - Intronic
1146455421 17:33005638-33005660 GAGGCAGAAGAGAAGCTGGAGGG - Intergenic
1146701247 17:34962056-34962078 GAGGAGGAAGAGGAGGAGGAAGG + Exonic
1146821192 17:35984663-35984685 GGGGTTGAAGAAAAGGAGGAAGG - Intronic
1147036455 17:37685181-37685203 TAGATGGAAGAGAGGGAGGATGG - Intergenic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1148106790 17:45123217-45123239 TAGGAGGAAGAGAAGGGAGAAGG - Intronic
1148108763 17:45132836-45132858 GACGCGGAAGGGAAGGAGGAGGG - Intronic
1148271460 17:46265401-46265423 TAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1148476456 17:47931901-47931923 GAAGCTGAAGAGAAAGAGGGGGG - Intergenic
1148612090 17:48971409-48971431 GAGGCTGCAGAGAAGGGGGTGGG - Intergenic
1148741472 17:49895396-49895418 TGGGCTGGAGAGAAGGACAACGG + Intergenic
1148851369 17:50557049-50557071 GAGGTGGAAGAGAGGGAGGATGG + Intergenic
1149285606 17:55160790-55160812 TTGGGTGCAGAGAAGGGGGAAGG - Exonic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1149819851 17:59765685-59765707 GAGGCTGAGGAGGAGGCGGAGGG + Intronic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1153505483 18:5792665-5792687 GAGGATGAAGAGTGGGAGGAGGG + Intergenic
1153546861 18:6216555-6216577 TAAACTGAAGAGATGTAGGAGGG - Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153861656 18:9216253-9216275 TAGGCTGAAGAGAAGGGAGAAGG - Intronic
1155789358 18:29946165-29946187 TAGGCTGAGGGGAAAGAGGAAGG + Intergenic
1156199871 18:34818461-34818483 TAGGGTGGAGAGTGGGAGGAAGG - Intronic
1156472876 18:37388476-37388498 GAGGAGGAAGAGGAGGAGGATGG - Intronic
1156632884 18:38991527-38991549 AAGGAGGAAGAGAGGGAGGAGGG + Intergenic
1156695314 18:39759371-39759393 TAGGCTGAGGAAGAGGAGGAAGG + Intergenic
1156724729 18:40114223-40114245 TGGGCTGGGGAGAAGGGGGAGGG - Intergenic
1156837075 18:41567264-41567286 AGGCCTGAAGAGATGGAGGAAGG + Intergenic
1156985054 18:43341301-43341323 TAGGATGGAGAGAGGGAGAAGGG + Intergenic
1157124781 18:44946127-44946149 TGGGCTGCAGAGAAGGGGCAGGG - Intronic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1157496836 18:48162215-48162237 AAGGCTGCAGGGAAGGAGGCTGG - Intronic
1157729055 18:49988158-49988180 TTGGGTGAAGAGGAGGAAGAAGG + Intronic
1157966244 18:52211493-52211515 TAGGAGGTAAAGAAGGAGGAGGG + Intergenic
1158044186 18:53135285-53135307 TAAGCTCAAGAGATGGAGGTGGG + Intronic
1158532376 18:58275297-58275319 TAAGCTGAGGAGGAAGAGGAGGG + Intronic
1159012356 18:63069923-63069945 TTGTCTGAAGATAGGGAGGAGGG - Intergenic
1159079756 18:63724063-63724085 GAGGAGGAAGAGAAGGAAGAAGG - Intronic
1160011131 18:75107796-75107818 GAGTCGGAAGAGAAGGAGGAAGG - Intergenic
1160480305 18:79233988-79234010 TAGGCTGAGGAGGAGGAGGAAGG + Intronic
1160545535 18:79650812-79650834 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1160667662 19:340575-340597 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1160676628 19:394619-394641 AAGGATGAAGGGAAGGATGATGG + Intergenic
1160695323 19:481201-481223 AAGGATGATGAGAAGGATGATGG + Intergenic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1160819840 19:1052686-1052708 TAGGAGGGAGAGGAGGAGGAGGG + Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1161208286 19:3053600-3053622 CAGGCTGCAGGGGAGGAGGAGGG + Exonic
1161329217 19:3678432-3678454 GAGGATGGAGAGATGGAGGATGG + Intronic
1161866000 19:6832585-6832607 TAGGAGGAAGAGGAAGAGGAGGG - Intronic
1161966832 19:7553795-7553817 GAGGAAGAAGAGGAGGAGGAGGG + Intronic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162561127 19:11418747-11418769 TGGGGTGAAGAGACCGAGGACGG - Exonic
1162823015 19:13234790-13234812 CTGCCAGAAGAGAAGGAGGAGGG + Intronic
1162836727 19:13324224-13324246 GAGGCTGCAGGGGAGGAGGAGGG + Intronic
1163966709 19:20753018-20753040 GAGGCTCCAGACAAGGAGGAAGG - Intronic
1164188317 19:22892767-22892789 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1164416346 19:28049201-28049223 TAGGCTGAACCTGAGGAGGATGG + Intergenic
1164441814 19:28284865-28284887 GAGGGTGGAGAGAAGGAGGGTGG + Intergenic
1165361939 19:35342091-35342113 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1166373574 19:42315209-42315231 GAGGATGAAGATGAGGAGGAAGG - Exonic
1166383284 19:42366587-42366609 TTCGCTGAAGAGAGGGAGGGAGG - Intronic
1166541276 19:43607708-43607730 GAGGAGGAAGAGGAGGAGGAGGG - Exonic
1166692761 19:44833578-44833600 AAGGAGGAAGAAAAGGAGGAAGG + Intergenic
1167033228 19:46977456-46977478 CCAGCTGAAGAGAGGGAGGAAGG - Intronic
1167312894 19:48747333-48747355 TGGGCAGAAGAGGCGGAGGAGGG - Intergenic
1167486497 19:49766288-49766310 TTGGCTGCAGAGAAGGGGGGAGG + Intergenic
1167608486 19:50494359-50494381 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1167737016 19:51300915-51300937 TAGGCAGAGGGGATGGAGGAGGG + Intergenic
1167783379 19:51615529-51615551 TGGGGTGAGGAGAAGGAGAACGG + Intronic
1168083365 19:54026965-54026987 TAGGTTGGAGAGGAGGAGAAAGG - Intergenic
1168335556 19:55595497-55595519 TAGGCTTTAAAGAAGGAGGGTGG - Intronic
1168431074 19:56281220-56281242 TAGGCTGACCAGAAGAAGGAAGG + Intronic
1168646812 19:58064412-58064434 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
925004851 2:434173-434195 AAGGATGCAGCGAAGGAGGAAGG - Intergenic
925018580 2:551291-551313 GAGGCTGCAGTGAAGGAGGTGGG + Intergenic
925169091 2:1740149-1740171 GAGGGTGCAGAGGAGGAGGAGGG + Intronic
925501979 2:4515075-4515097 TAGGTGGGAGAGAAGGCGGATGG + Intergenic
925672199 2:6323235-6323257 AAGGCTGCAGAGAAGAGGGAAGG + Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925715776 2:6782997-6783019 GAGCCTGATGGGAAGGAGGAGGG - Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926412532 2:12619617-12619639 GAGGAAGAAGAGAGGGAGGAGGG - Intergenic
926709294 2:15864476-15864498 TAGGCTGAAGGGGAAGAGGAAGG - Intergenic
926772318 2:16389411-16389433 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
926962850 2:18377899-18377921 TGGACTGAATGGAAGGAGGATGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
926996726 2:18743151-18743173 TAGGCAGGAGAGAAGGAGCAGGG + Intergenic
927026806 2:19076708-19076730 GAGGCAGTAGTGAAGGAGGAAGG - Intergenic
927493255 2:23534584-23534606 TGAGCAGAAGAGAAGGAAGACGG - Intronic
927561696 2:24077812-24077834 AAGGCTGAGGAGGATGAGGAGGG - Intronic
928096300 2:28407147-28407169 GAGGCAGAAAAGAAGGAGGCTGG - Intronic
928105814 2:28470025-28470047 TGGGATGAAGAGGAGGGGGAAGG + Intronic
928724223 2:34152165-34152187 TAGGCTGAGGAGGAGGAAGCAGG - Intergenic
928893819 2:36238300-36238322 TTGGAAGAAGAGAAGGAAGATGG - Intergenic
929013602 2:37472337-37472359 GAGGAGGAAGAGAAGGAGAAAGG + Intergenic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929215652 2:39409082-39409104 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
929237745 2:39624428-39624450 AAGGCAGTGGAGAAGGAGGAGGG + Intergenic
929604272 2:43224914-43224936 GAGGCCGAAGAGCAGGAGGGCGG + Exonic
929855243 2:45632101-45632123 TGGTCTGAAGAGCAGGAAGAGGG + Intergenic
930084063 2:47480221-47480243 AAGGGGGAAGGGAAGGAGGAAGG - Intronic
930218348 2:48720313-48720335 AAGGCAGAAGACATGGAGGAGGG - Intronic
930343859 2:50152913-50152935 GAGGGAGAAGAGAAGGAGAAAGG - Intronic
930354966 2:50306694-50306716 TTAGCTGAAGTGTAGGAGGAGGG - Intronic
930364627 2:50424123-50424145 GAGGCGGAGGAGGAGGAGGAGGG + Intronic
930365619 2:50435802-50435824 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
930495079 2:52131202-52131224 TCCTATGAAGAGAAGGAGGAAGG - Intergenic
930762800 2:55053960-55053982 AAGACTGGAGAGAAGGAGAAGGG + Intronic
930926538 2:56824665-56824687 GAGGCTGGAGGGTAGGAGGAAGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931600434 2:63997238-63997260 TAGTCTGAAAAATAGGAGGAGGG - Intronic
932073692 2:68644355-68644377 TCAGCTGAAAAGAAGGAGGGGGG - Intronic
932659646 2:73641270-73641292 GAGTCTGAAGAGAAGGTGGTGGG - Exonic
933012179 2:77080283-77080305 GAGGCTGAAGAGAAGAATAAAGG - Intronic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933412209 2:81940605-81940627 TAGGCAGCAGAGGAGGGGGATGG - Intergenic
934185639 2:89671467-89671489 TAGGGGGAAGAGTAGGAGGAGGG - Intergenic
934316804 2:91929113-91929135 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934653540 2:96105544-96105566 TAGGCTGAAGATGGGCAGGAAGG - Intergenic
935626659 2:105177269-105177291 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
935654067 2:105406851-105406873 CAGGCAGAAGAGAGTGAGGAAGG - Intronic
935933231 2:108152703-108152725 TGGGCACAAGAGAAGGGGGAGGG + Intergenic
936378874 2:111966879-111966901 TGAGCAGGAGAGAAGGAGGAAGG - Intronic
936444050 2:112582309-112582331 TAGGCTGAGGAGAGGAAGGGGGG + Intergenic
936561059 2:113540450-113540472 GAGGCTGAAGAAAAGAAGAATGG - Intergenic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937060285 2:118975574-118975596 TAGGCAGACCAGAAGAAGGAAGG + Intronic
937110333 2:119362068-119362090 TAGGCTGAGGAGGAAGAGGAAGG - Intronic
937350918 2:121160823-121160845 GAGGCGGAGGAGAAGGAAGAAGG - Intergenic
937481767 2:122268993-122269015 TAGTCTGGAGAGAGGGTGGAAGG - Intergenic
937769752 2:125706565-125706587 GAGGCTGAAGAGAAATAGGCTGG + Intergenic
937969108 2:127536033-127536055 GGGGCTGAGGAGGAGGAGGAGGG + Intronic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938120163 2:128627410-128627432 TAGGCCGAAGAGCAGAAGGGAGG - Intergenic
938137165 2:128769048-128769070 TAGGAAGAAGAGAAGGGGGAGGG + Intergenic
938181979 2:129192006-129192028 TAGGCTGAAGGAACAGAGGAAGG + Intergenic
938557108 2:132435296-132435318 TAGGCTGAGGAGAACGAGGAAGG - Intronic
939039554 2:137171820-137171842 AAGGATGAAGAGAGGGAGGGAGG - Intronic
939175630 2:138744641-138744663 GAGGCTCAAGAAAAGGAAGAAGG - Intronic
939539180 2:143472703-143472725 AATGATGAAGAGGAGGAGGAAGG + Intronic
939820063 2:146946643-146946665 GAGGGTGGAGAGAAGGAGGAGGG + Intergenic
939911107 2:147984237-147984259 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
940010147 2:149044585-149044607 TTGGAGGAAGAGAAGGAGGGAGG - Intronic
940090194 2:149906904-149906926 TTGACTGAAGAGAAGGATAATGG - Intergenic
940092729 2:149938947-149938969 GAGGCTGCAGAGCAGAAGGAGGG - Intergenic
940437106 2:153668602-153668624 TAGGATGAAGGGAAGGAAGCTGG + Intergenic
940579848 2:155564712-155564734 TAGGCGGAAGAGAGGGAGGGAGG - Intergenic
940775027 2:157876122-157876144 CGGGGTGAAGAGGAGGAGGAAGG + Intergenic
940897363 2:159093742-159093764 GAGGCTTAAGAGAAGAGGGAGGG - Intronic
941050096 2:160722981-160723003 GAGGCTGTAGAGAAATAGGAAGG - Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941388130 2:164878349-164878371 TTGGCTGAAGAGGATGAGAATGG - Intergenic
941457092 2:165721983-165722005 TACTCTGAAGAGCAGGAGGTGGG - Intergenic
941629254 2:167865975-167865997 TAGGATGATGGGGAGGAGGATGG - Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941885358 2:170522062-170522084 TAAGCGGAAGAGAAGAAGAATGG - Intronic
942146922 2:173035907-173035929 TAGGCTCAGGAGGAGGAGAAGGG + Intronic
942211799 2:173678381-173678403 AAGGAGGAAGGGAAGGAGGAGGG + Intergenic
942552395 2:177132927-177132949 TAGGGTGGAGAGGAGTAGGAGGG - Intergenic
942807565 2:179950628-179950650 GACGCTGAAGAGGAAGAGGATGG + Exonic
942980137 2:182070878-182070900 TAGGAGGAAGAGAGGGAGGAGGG + Intronic
943103513 2:183514278-183514300 TAGGCTGAGGAGGAAGAGGAGGG - Intergenic
943456079 2:188108847-188108869 GAGGTTGGAGAGTAGGAGGAGGG + Intergenic
943532666 2:189103884-189103906 TAGGAGGAAGGGAAGGAGGAAGG - Intronic
943533626 2:189119252-189119274 GAGGATGAAGAGAGGAAGGAGGG + Intronic
943547347 2:189296966-189296988 TAGTCTGAAGAGGCAGAGGATGG - Intergenic
943693870 2:190901406-190901428 TAGACTGAAGAAGAAGAGGAGGG + Intronic
943708323 2:191060065-191060087 TAGGGTGCAGAGGAGGAGGATGG + Intronic
943995962 2:194765883-194765905 GAGGCAGAAGGGATGGAGGATGG - Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944229771 2:197380911-197380933 TAGGTGGGAGAGAAGGAGGACGG + Intergenic
945033633 2:205686218-205686240 TAGGAGGAGGAGGAGGAGGAGGG - Intronic
945110175 2:206355487-206355509 TAGGAAGAAGAGAGGGAGGAAGG - Intergenic
945147135 2:206750204-206750226 GAGGCAGAGGAGAAGCAGGAAGG - Intronic
945275280 2:207982011-207982033 TAGGCTGAGGAGGAAGAGAAGGG - Intronic
945483416 2:210367695-210367717 TAGTCTGAGGAGAACTAGGAAGG + Intergenic
945488741 2:210429385-210429407 AAGGCTGAAGAGGAGGAGAAAGG + Intergenic
945768300 2:214007964-214007986 AGGGGTGAAGAGAAGGAGGGAGG - Intronic
945893855 2:215459991-215460013 GAGACAGAAGAGAAGGAGGGAGG - Intergenic
945988967 2:216377583-216377605 GAGGAAGAAGAGGAGGAGGAGGG + Intergenic
946025459 2:216669299-216669321 AAGGATTAAGAGAAGGAAGAGGG + Intergenic
946045297 2:216816036-216816058 AGGGAAGAAGAGAAGGAGGATGG - Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946724108 2:222644378-222644400 GAGAATGAAGAGGAGGAGGAAGG + Intronic
946919637 2:224565388-224565410 CAGGCACAAGAGATGGAGGAGGG + Intronic
946972007 2:225104134-225104156 GAGGCTGAATAGGAAGAGGAGGG - Intergenic
946990975 2:225329059-225329081 CAGGCGGAAGAGAAAGAGTAGGG + Intergenic
947077353 2:226359778-226359800 CAGGCAGGAGAGAGGGAGGAAGG + Intergenic
947098433 2:226592486-226592508 GAGGGTGAAGAGAAGCAGGGTGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947459462 2:230290671-230290693 TTGGCTTGAGGGAAGGAGGAAGG + Intronic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
947522013 2:230853533-230853555 TATCCTTGAGAGAAGGAGGAGGG + Intergenic
947602221 2:231460668-231460690 GAGGAAGAAGAGGAGGAGGAAGG - Exonic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
947836460 2:233179486-233179508 GAGGCTTTAGAGAAAGAGGAGGG + Intronic
947894765 2:233659557-233659579 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
947901095 2:233722941-233722963 TGGGCTGAGGAGGAGGAGGAAGG + Intronic
948209595 2:236183052-236183074 AAGGAGGAAGACAAGGAGGAGGG - Intergenic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948556046 2:238812122-238812144 GAGGATGACGAGAAGGAAGAAGG - Intergenic
948707182 2:239802209-239802231 TTGGCTGAGGAGTAGCAGGAAGG + Exonic
948751939 2:240138024-240138046 TAGGCTGTAGAGAAGGGGAGTGG + Intergenic
948856047 2:240731141-240731163 TAGGCTAGTGAGAAGGAGGTGGG + Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168776541 20:452811-452833 TAGTCTGAGGAAAAGGAGGAAGG + Intronic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169855890 20:10102312-10102334 TAGGATGAGGAGGAAGAGGAGGG - Intergenic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1169934226 20:10865719-10865741 CAGGTTGAAGAGGAGTAGGAGGG + Intergenic
1170389740 20:15859206-15859228 TGGGCTGAGGAGGAAGAGGAAGG + Intronic
1170444000 20:16406124-16406146 AAGGCTGAAGAGAAGGATCTAGG + Intronic
1170602436 20:17851130-17851152 TGGGCTGAGGAGGAGGAGGAAGG + Intergenic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1170813332 20:19692489-19692511 TATGTTGAAAAGAAGAAGGAAGG + Intronic
1171040319 20:21756829-21756851 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1171161388 20:22927288-22927310 TAGGCTGAGGAGGAGGAGGAAGG - Intergenic
1171796754 20:29572446-29572468 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1171851493 20:30311720-30311742 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1171872063 20:30536452-30536474 TAGGGTGGAGGGAAGGGGGAGGG - Intergenic
1172119226 20:32588026-32588048 GAGACTGAAGTGAGGGAGGAGGG + Intronic
1172800871 20:37575173-37575195 TAAGATGGAGAGAGGGAGGAGGG + Intergenic
1172928629 20:38564869-38564891 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1172984993 20:38978441-38978463 TAGGTGGGAGAGAAGGCGGATGG + Intronic
1173134066 20:40423801-40423823 AAGACTGAAGAAGAGGAGGAAGG + Intergenic
1173138322 20:40459731-40459753 TAGGATGAGGAGTAGAAGGAAGG + Intergenic
1173143556 20:40505778-40505800 TGGGCTGAAGAGAGAAAGGAGGG + Intergenic
1173317117 20:41955022-41955044 CAGGCTGAAGGGGAGGAAGAAGG - Intergenic
1173338185 20:42130288-42130310 TGGGCTGAAGGGATGGAGGGAGG + Intronic
1173538983 20:43837603-43837625 TAGGCTGGGGAGGAAGAGGAGGG + Intergenic
1173566221 20:44040333-44040355 TGGGCTGAAGAAGAGCAGGAAGG + Intronic
1173624460 20:44462084-44462106 AAGGCTGAAGACAGGCAGGAGGG + Exonic
1173907987 20:46642629-46642651 TAAGATGAAGAGAGGAAGGAAGG - Intronic
1174287543 20:49483510-49483532 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1174960197 20:55147735-55147757 GAGGCAGAAGAGAAAGATGAAGG - Intergenic
1175293671 20:57894652-57894674 AAGGAAGAAGGGAAGGAGGAAGG + Intergenic
1175794016 20:61760155-61760177 AAGGCTGAAGGGTAGGGGGAGGG + Intronic
1176037885 20:63049218-63049240 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1176037907 20:63049294-63049316 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1176664316 21:9670457-9670479 TCTGCTGAAGAGAAGTGGGATGG - Intergenic
1177249359 21:18572220-18572242 AAGCAGGAAGAGAAGGAGGATGG + Intergenic
1177346383 21:19877593-19877615 GAGGCTGAAGAGAAAAGGGAAGG + Intergenic
1177469734 21:21545140-21545162 TTGGCTGAAGAGAAGGAAATAGG + Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178053019 21:28768553-28768575 TAGGCTGAACATGAGGAGAAGGG - Intergenic
1178165700 21:29973609-29973631 TAGACTATTGAGAAGGAGGAAGG - Intergenic
1178563180 21:33658246-33658268 TAGGCTGAGGAGGAGGAAGAAGG + Intronic
1179009215 21:37541644-37541666 AAGGTTGAAGAGAAATAGGAAGG - Intergenic
1179048694 21:37870034-37870056 GAGGATGAAGGGAAGGAGAAAGG + Intronic
1179188948 21:39107250-39107272 AAGGCGGAAGAGGAAGAGGAAGG + Intergenic
1179215866 21:39366817-39366839 AAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1179333809 21:40431294-40431316 TAGGCTGAGGAGGAGGAAGGGGG - Intronic
1179488590 21:41726512-41726534 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1179812996 21:43884283-43884305 TCAGCAGGAGAGAAGGAGGAGGG - Intronic
1180543135 22:16471460-16471482 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1180713472 22:17855890-17855912 CAGGCTGCAGAGAATGATGAAGG + Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181595262 22:23910315-23910337 TTGGGTGAAGAGTTGGAGGAGGG - Intergenic
1181711845 22:24696136-24696158 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1181883399 22:25999576-25999598 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1182078749 22:27513927-27513949 TCGGCTGAAGAAGAGGTGGATGG - Intergenic
1182442134 22:30370800-30370822 GAGGCTGAAGGGCAGAAGGATGG + Exonic
1182904398 22:33922388-33922410 GAGGCTGGAGGGAAGGGGGATGG - Intronic
1182985872 22:34715760-34715782 GAGGAGGAAGAGAAAGAGGAGGG - Intergenic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183097893 22:35564754-35564776 TAGTCTGAAAAGTAGGAGCAAGG - Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1184244035 22:43226957-43226979 GAGGCTGAGGGGGAGGAGGAGGG - Intronic
1184449712 22:44575756-44575778 GAGGAAGAAGGGAAGGAGGAAGG + Intergenic
1184525263 22:45019049-45019071 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1184612450 22:45613404-45613426 TAGGCTGAAGGGGAGGAGGATGG - Intergenic
1184620356 22:45672020-45672042 GAGCCTGACGAGGAGGAGGAAGG - Exonic
1184676355 22:46045335-46045357 TTGGCTGGAGGGAAGGAGGAGGG + Intergenic
1185110315 22:48896856-48896878 GAGGCTGATGGGGAGGAGGAAGG + Intergenic
949949361 3:9216484-9216506 CAGCCTGAAGTGTAGGAGGAAGG - Intronic
949977549 3:9474848-9474870 AAGGATGAAGAGAAAGAAGACGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950606898 3:14089751-14089773 GACGTGGAAGAGAAGGAGGATGG + Intergenic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950905055 3:16530519-16530541 AGGGAAGAAGAGAAGGAGGAGGG - Intergenic
950997715 3:17521303-17521325 TAGGCTGAGGAGGAGGTGGAAGG - Intronic
951520875 3:23609831-23609853 AAGGAAGAAGGGAAGGAGGAAGG + Intergenic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951595045 3:24309468-24309490 TAGGCTGAAGGGAAGGAGTGGGG - Intronic
951705599 3:25541243-25541265 GAGGCTGAAGAGGATGAGGAGGG - Intronic
951891603 3:27572872-27572894 TAGGAGGTAGAGAGGGAGGAAGG - Intergenic
952051543 3:29390218-29390240 TAGGCAGAAGAGATGGGGAAAGG - Intronic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952244121 3:31566714-31566736 TGGGAAGAAGGGAAGGAGGAAGG - Intronic
952464302 3:33565059-33565081 TAGGCTAAGGAGGAAGAGGAGGG - Intronic
952488425 3:33840322-33840344 TAGGCTGAGGAAGAGGCGGAAGG + Intronic
953279235 3:41536724-41536746 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
953367186 3:42354835-42354857 GAGGTGGGAGAGAAGGAGGAGGG - Intergenic
953405820 3:42659295-42659317 GAGGAAGAAGAGGAGGAGGACGG + Exonic
953536837 3:43783086-43783108 TGGGCAGGAGAGAAGAAGGAAGG + Intergenic
954334023 3:49905738-49905760 AAGGCTGTAGATAAGGAGGCTGG + Intronic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954652152 3:52171762-52171784 TTGGCTGGAGAGAAGGCGAAGGG + Intergenic
954775094 3:53009918-53009940 TAGGCTGAAAAGGAAGAGGATGG + Intronic
955220455 3:57019105-57019127 TAGGCTGGAGGCCAGGAGGATGG - Intronic
955285377 3:57635877-57635899 TAGGTTGAAGAGGAAGAGGAGGG - Intronic
955506956 3:59641914-59641936 TGGGATGAAGAGACGGAGAAAGG + Intergenic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
956065819 3:65396074-65396096 GAGGCTTAGGAGCAGGAGGATGG + Intronic
956407452 3:68943087-68943109 CAGGCTGAAGAGAACGAGACGGG + Intergenic
956552873 3:70481278-70481300 TTGGAGGAAGAGAAGGAGTAGGG + Intergenic
956705737 3:71997464-71997486 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
956847927 3:73200979-73201001 CAGGCTGAAGGGAATGAGGAGGG - Intergenic
956874107 3:73445032-73445054 TAGGCTGAAGTGAAGCAGGAAGG + Intronic
956988848 3:74738804-74738826 TTGGCTGAAAAGGGGGAGGAGGG - Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957240079 3:77648443-77648465 TATGCTGAAGACAATCAGGAAGG - Intronic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957520342 3:81311215-81311237 GAGGAGGAAGAAAAGGAGGAAGG + Intergenic
957755660 3:84483081-84483103 GAGGCTGAGGGGAAAGAGGATGG + Intergenic
957859033 3:85919384-85919406 ATGGCTGAAGGAAAGGAGGAAGG + Intronic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958997967 3:100927619-100927641 TAGGAGGAAGAGAAAGAGGAAGG + Intronic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
959099000 3:101989157-101989179 TAGTTTGAAGTGATGGAGGAGGG + Intergenic
959290075 3:104462641-104462663 AAGTCTGAAGAAAAGGAGGCAGG - Intergenic
959734043 3:109637363-109637385 GAGGCTGAAGAGTGGGAGGAGGG - Intergenic
959963832 3:112332291-112332313 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960520197 3:118645979-118646001 AAAGCTGAAGAGGAGGTGGAAGG + Intergenic
960883231 3:122367134-122367156 AAGGATGAAGAGAAGGAGAGAGG + Intronic
960883236 3:122367157-122367179 GAGGGTGAAGAGAAGGAGAGAGG + Intronic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
960962779 3:123083860-123083882 TAGACTGAAGTGGAGGAGAAAGG + Intronic
962256578 3:133874020-133874042 TAGGCTGAAGAGGAGGAGGAAGG + Intronic
963096290 3:141544989-141545011 GAGGGTGGAGAGTAGGAGGAGGG + Intronic
963943207 3:151115957-151115979 GAGGCTGAGGAAAAGGAGAATGG + Intronic
964386836 3:156156422-156156444 TAGGCTGAAAAGTAGAAGTAGGG + Intronic
964441716 3:156718169-156718191 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
964471746 3:157064191-157064213 TAGGCTCATCAGATGGAGGAGGG - Intergenic
964537935 3:157746096-157746118 TAGGGTGAGAAGGAGGAGGAAGG + Intergenic
964762423 3:160146850-160146872 TTGGAGGAAGAGAAGGTGGAGGG - Intergenic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965210281 3:165777776-165777798 TAGGCTGAGGAGTAGGAGGAGGG - Intronic
965440721 3:168710402-168710424 TAGGCTAAGAAGAAGAAGGAGGG - Intergenic
966031387 3:175352292-175352314 GAGGCTGAGGAGAAGAAGGAAGG + Intronic
966422292 3:179745541-179745563 TGGGAGGAAGGGAAGGAGGAAGG - Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966830763 3:184006420-184006442 TAGGAAGGAGAGCAGGAGGAAGG - Intronic
966908562 3:184544718-184544740 TAGGAGGAAGAGGAGTAGGAGGG - Intronic
966937397 3:184719974-184719996 GAGACTCAAGGGAAGGAGGAAGG + Intergenic
966951228 3:184819992-184820014 TAGGCTGAGGAGGAGGAGGAGGG + Intronic
967106970 3:186261864-186261886 GAGGCAGATGAGAAGCAGGAGGG + Intronic
967122753 3:186397983-186398005 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
967277979 3:187795314-187795336 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
967287595 3:187888642-187888664 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
967293304 3:187942751-187942773 TAGGTGGAAGAGAAGCGGGAAGG - Intergenic
967451786 3:189632576-189632598 AAGGCAGAAGAGAAAGAGCAAGG + Intronic
968073277 3:195801507-195801529 CAGGCAGGAGAGAAGGAGAAAGG - Intronic
968837537 4:2976210-2976232 AAGGAAGAAGGGAAGGAGGAGGG - Intronic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
969547814 4:7843290-7843312 TATGATGAAGAGGAGGAGGATGG - Exonic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
969749576 4:9100009-9100031 GAGGCTCCAGACAAGGAGGAAGG + Intergenic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970113926 4:12671431-12671453 TTGGCTGAGGAGGAGGAGGAGGG + Intergenic
970209920 4:13698516-13698538 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
970310385 4:14776723-14776745 TAGGCTTAAGCTAAGGGGGAAGG - Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
970827308 4:20291367-20291389 TTGGCTGAGGAGGAGGAGAATGG + Intronic
971035875 4:22692428-22692450 AAGGTGGAAGAGAAGGAGGGAGG + Intergenic
971361993 4:25946627-25946649 TAGGCAGAGGAGGAGAAGGAGGG + Intergenic
971420247 4:26467875-26467897 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
971865169 4:32160513-32160535 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
972086123 4:35218870-35218892 TAGGCTGAGGAGAAGAAAGAGGG - Intergenic
972409507 4:38778786-38778808 TATGCTCAACAGAAAGAGGATGG + Intronic
972826142 4:42761361-42761383 TAGGCAAAATAGAAGCAGGAAGG - Intergenic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973176167 4:47208324-47208346 GAGGCTGAAGAGATGGGGAATGG + Intronic
974020473 4:56688086-56688108 GAGGATGAGGAGAAGAAGGAAGG + Intergenic
974228119 4:59075241-59075263 TATGCTAAGGAGAAGAAGGAAGG + Intergenic
974441446 4:61923627-61923649 TGGAATGAAGAGAAGGAGAAAGG - Intronic
974570176 4:63635629-63635651 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
975022668 4:69508703-69508725 GAGGCTGAAGAGCGGGAGGAGGG + Intronic
975319537 4:72994742-72994764 AGGGAGGAAGAGAAGGAGGAGGG - Intergenic
975362350 4:73485675-73485697 GAGGTGGAAGAGAAGGAGGGGGG + Intronic
975471746 4:74777272-74777294 TGTGCTGAAAAGAAGGTGGAGGG + Intronic
975504449 4:75122849-75122871 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
975567825 4:75778419-75778441 TAGGCTGAGGAGCAAAAGGAAGG + Intronic
975891137 4:79029140-79029162 CAGGCAGGAGAGAGGGAGGAGGG - Intergenic
975936077 4:79582512-79582534 TGGTGTGAAGAGGAGGAGGATGG + Intergenic
976153863 4:82121299-82121321 CAGGCAGGCGAGAAGGAGGAAGG + Intergenic
976380496 4:84393128-84393150 TGGGAAGAAGAGAAGGAGGGAGG + Intergenic
976426845 4:84913906-84913928 TAGGCTGAGGAGGAAGAGAAGGG - Intronic
976786107 4:88823365-88823387 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
977176833 4:93828954-93828976 TGGGCTGAAGTGAAGGAGTTGGG + Exonic
977664672 4:99632250-99632272 TCGGCAGAAGGGAAGGGGGAAGG - Intergenic
977855464 4:101885338-101885360 TAAACTGGAGAGAAGGAGAAGGG - Intronic
977858271 4:101922666-101922688 TATGCTGAAGACAAGCAGTAGGG - Intronic
977948643 4:102943738-102943760 TAGGGGGAAGAGTAGGAGGAGGG + Intronic
978268543 4:106859006-106859028 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
978276383 4:106955867-106955889 TAAGCTGGAGTGCAGGAGGAGGG - Intronic
978320636 4:107490808-107490830 GAGGCTGGAGGGTAGGAGGAAGG + Intergenic
978693795 4:111550447-111550469 GAGGATGGAGAGTAGGAGGAGGG + Intergenic
979007069 4:115312811-115312833 AAGGTTGCAGAGAAAGAGGAAGG + Intergenic
979174444 4:117645604-117645626 TAGTGTTGAGAGAAGGAGGAAGG - Intergenic
979397479 4:120205957-120205979 TAGACTGAAGAGGAAGAGGGTGG + Intergenic
979514155 4:121587646-121587668 TAGGCTGAAGAGAAATAGGCAGG - Intergenic
979616262 4:122746162-122746184 TAGGCTGAAGAGAAGGAAGAGGG + Intergenic
979690429 4:123553469-123553491 TAGGGTGAAGTGGAGGGGGATGG - Intergenic
979879118 4:125931727-125931749 GAGGGTGAAGGGTAGGAGGAAGG - Intergenic
980092331 4:128455623-128455645 GAGGGGGAAGGGAAGGAGGAAGG + Intergenic
980190677 4:129520487-129520509 GAGGAAGAAGAGAAGGAGGAGGG + Intergenic
980726579 4:136769633-136769655 GAGGGTGAAGAGAAGGAAGTGGG - Intergenic
980875640 4:138659410-138659432 GAGGGAGAAGAGAAGCAGGAGGG + Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
980907553 4:138962981-138963003 TAGGCTGAGGAGGAAGAAGAGGG + Intergenic
981093495 4:140756380-140756402 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
981182763 4:141765094-141765116 GAGGATGAAGGGCAGGAGGAGGG - Intergenic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
981241712 4:142484753-142484775 AAGGGTGGAGAGTAGGAGGAGGG - Intronic
981295600 4:143127379-143127401 TAGAAGGAAGAGGAGGAGGAAGG + Intergenic
981448095 4:144864133-144864155 TAGGGTGGAGGGAGGGAGGAAGG + Intergenic
981495484 4:145386983-145387005 TAGGCTGAGGAGGAAGAAGAGGG + Intergenic
981616086 4:146646469-146646491 AGGGAGGAAGAGAAGGAGGAAGG - Intergenic
981713191 4:147728957-147728979 TGGGCTGAAGAGAGGGATGAGGG - Intergenic
981902652 4:149884909-149884931 GAGTCTGAAGGGAGGGAGGAGGG + Intergenic
982088518 4:151860871-151860893 AAGGCTGAAAGCAAGGAGGATGG - Intergenic
982473943 4:155827295-155827317 TAGGCTGAGGAGGAGGAGACAGG - Intergenic
982592026 4:157325791-157325813 TTGGCTGAAGAGAAGGTGGTAGG - Intronic
983155643 4:164344223-164344245 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
983383547 4:167027803-167027825 TAAGCCGAGGAGGAGGAGGAAGG + Intronic
983589337 4:169390392-169390414 TAGGCTGAGGAGGAGGAGGAAGG + Intergenic
983595856 4:169467003-169467025 TAGGCTGAAGAGGAGGAAGTTGG - Intronic
983647895 4:170010512-170010534 TAGACTGAGGAGGAGGGGGAGGG - Intronic
984687365 4:182685217-182685239 AGGGAAGAAGAGAAGGAGGAAGG - Intronic
984716106 4:182926729-182926751 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
984868762 4:184308999-184309021 GAGGCTGAAGAGGAGGAAGAGGG + Intergenic
984881616 4:184414444-184414466 GAGGCTGAGGTGTAGGAGGATGG - Intronic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985263306 4:188135321-188135343 TAGGCTGAGGAGGAGGAGGTGGG - Intergenic
985409780 4:189671136-189671158 TCTGCTGAAGAGAAGTGGGATGG - Intergenic
985797395 5:1973118-1973140 AAGGAAGAAGAGAAGAAGGAAGG - Intergenic
985923907 5:3000785-3000807 TAGGCGGTGGAGAAGGAGTAGGG + Intergenic
986236847 5:5918717-5918739 AAGGAAGAAGAGGAGGAGGAAGG + Intergenic
986520214 5:8607638-8607660 GAGGCTGATGACAAGGTGGAAGG + Intergenic
986673527 5:10164184-10164206 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
986796528 5:11218044-11218066 GAGGAAGAAGGGAAGGAGGAAGG - Intronic
986896653 5:12379157-12379179 GAGGGTGAAGGGTAGGAGGAGGG - Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987177840 5:15334705-15334727 TAGGCTGAAGAGCAGAAGTTGGG + Intergenic
987550947 5:19380648-19380670 TAGGGTGAAGGGTGGGAGGAGGG + Intergenic
987738094 5:21870681-21870703 TTGGCTGAAGATAAAGAGGATGG - Intronic
988153133 5:27413633-27413655 TAGAGTGAAGAGGAGGAGCAAGG - Intergenic
988296027 5:29363379-29363401 TAAGCTGAGGAGGAGGAAGAGGG + Intergenic
988401024 5:30760509-30760531 TAGGCTGAGGAGGAGGAAGACGG - Intergenic
988494375 5:31732498-31732520 AAGGCTGAGCAGAAGGAGGTGGG + Intronic
988573453 5:32395677-32395699 TAGGCTGAGGAAGAAGAGGAGGG - Intronic
988710642 5:33770838-33770860 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989983737 5:50672037-50672059 AAGGCTCAGGAGAAAGAGGAAGG - Intronic
990780245 5:59352783-59352805 TAGACTGAACAGTAGAAGGAAGG - Intronic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991061469 5:62380789-62380811 TAGGCTGAGGAGGAAGAGGCAGG + Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991553735 5:67872097-67872119 TTGGAAGAAGAGCAGGAGGAGGG + Intergenic
992426952 5:76667681-76667703 GAGGCTGAAGAGAGGGGTGAAGG - Intronic
992475417 5:77097142-77097164 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
992765533 5:79995595-79995617 GATGCTGGAGAGAAGAAGGATGG + Intronic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993261854 5:85667678-85667700 AAGGCTGAAGAGGAGGAGAAAGG - Intergenic
993310167 5:86319813-86319835 TAGGCTGAAGATGAGCATGAGGG + Intergenic
993622588 5:90186285-90186307 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
993910985 5:93683736-93683758 TAGGTAGGAGAGAAGGCGGACGG + Intronic
994030471 5:95136158-95136180 AAGGTTGAAGAGAGGGAGAAGGG - Intronic
994435186 5:99720594-99720616 GAGGCAGAAGAGTGGGAGGAAGG + Intergenic
994501400 5:100583183-100583205 TAGGCTGAAGAGAAGGAGGAAGG + Intronic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
995195233 5:109359066-109359088 TAAGCTGAGGAGGAAGAGGAGGG - Intronic
995551252 5:113283890-113283912 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
996034585 5:118744002-118744024 AGGGAAGAAGAGAAGGAGGAAGG + Intergenic
996500460 5:124210568-124210590 AAGGCTGAAGAGAAGAGAGAAGG + Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
997035543 5:130186834-130186856 AAAGCTGAAGAGATTGAGGAAGG - Intergenic
997222374 5:132180216-132180238 TAGGCTGATGAAAAGGAGCCAGG + Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
997759617 5:136432733-136432755 GAGGCTGCAAAGAAGGAGAAAGG + Intergenic
998012554 5:138707172-138707194 TAGCCTGAAGAAAAGGAGCCAGG + Intronic
998377110 5:141698482-141698504 AAGGCGGAAGAGAAGGAAGAGGG - Intergenic
999090446 5:148931658-148931680 AAGGAGGAAGAGAAGGAGGGAGG - Intronic
999134274 5:149307440-149307462 TACGATGAAGAGGAGGAGGAAGG + Exonic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999310820 5:150550792-150550814 AAGGCTGAAGAGATGGATGTGGG - Intronic
1001392123 5:171387908-171387930 TAGGTAGGAGAGAAGGCGGACGG - Exonic
1001547866 5:172581631-172581653 GAGGCTGGAGGGAAGGAGGGAGG - Intergenic
1001600099 5:172923072-172923094 TAGGAGGAGGAGGAGGAGGAGGG + Intronic
1001664941 5:173424759-173424781 CAGGCTGGTGAGAAGGAAGATGG - Intergenic
1001722871 5:173870807-173870829 GAGGCTGAAGAGCAGCAGGGAGG + Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1002189180 5:177469948-177469970 AAGGGAGAAGAGAAAGAGGAGGG + Intronic
1002275413 5:178101369-178101391 TAGGCTGGAGGGAAAGAGGGAGG - Intergenic
1003001398 6:2338009-2338031 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1003179921 6:3782631-3782653 TGGGTTGGAGAGAAGGAGCAGGG + Intergenic
1003306392 6:4933094-4933116 GAGGCAGCAGAGAAGCAGGAAGG - Intronic
1003355518 6:5365948-5365970 TAGGCTGAAGAGGAAGAGGAGGG + Intronic
1003389651 6:5702812-5702834 TAGGACTAAGAGAATGAGGAGGG + Intronic
1003477219 6:6494727-6494749 TAGGCAGATGAGCAGAAGGAGGG - Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003781951 6:9439228-9439250 TAGGCTGAGAAGGATGAGGAGGG + Intergenic
1004173202 6:13315248-13315270 TAGGCTGAGCAGGAGGAGGGAGG - Intronic
1004446688 6:15706592-15706614 TAGGCTGAGGAGGAGGAGGGAGG - Intergenic
1004485623 6:16063644-16063666 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1004820324 6:19361106-19361128 TTGGATGCAGAGAATGAGGAAGG - Intergenic
1004977258 6:20981883-20981905 TATGCTGAAGTGAACTAGGAAGG - Intronic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1006630491 6:35426969-35426991 AAGTCTCAAGAGAAGGAGGGGGG + Exonic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1007835522 6:44671177-44671199 GAGGCTGCAGAGAAGGAAGGTGG - Intergenic
1008366350 6:50685218-50685240 TACTCTGAAAAGAAGGAGGCAGG - Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1009554066 6:65139433-65139455 GAGGGTGAAGGGAAGGAAGAGGG + Intronic
1010389279 6:75319069-75319091 GAGGATGAAGAGGAGGAAGAAGG - Intronic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1011062379 6:83285512-83285534 CATGCTGTAGAGAAGGAAGAAGG + Intronic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011489304 6:87874261-87874283 AAGGCAGAAGGGCAGGAGGAGGG + Intergenic
1011753117 6:90473103-90473125 TGGGCTGAGCAGAAGGAAGAGGG - Intergenic
1011787617 6:90864511-90864533 TAGGGTGCAGAGAAGGTGGATGG + Intergenic
1011920288 6:92566095-92566117 TAGGCCGAGGAGGAGGAGGAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012242411 6:96888540-96888562 TAGGGTGAGGAGAGGAAGGAAGG - Intergenic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1012583893 6:100899335-100899357 TAGGAGGAAGATAAGGGGGAGGG + Intergenic
1012848940 6:104424225-104424247 AAGGAGGAAGGGAAGGAGGAAGG + Intergenic
1013171190 6:107637673-107637695 GAGGCTGAAAAGAAGAAGAATGG + Intronic
1013437649 6:110127809-110127831 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1013604058 6:111731790-111731812 TTGCCTGAAGGAAAGGAGGATGG + Intronic
1013628841 6:111965078-111965100 GAGGCGGAGGAGGAGGAGGAGGG + Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014318339 6:119894498-119894520 GAGGAGGAAGAGAAGGACGAAGG - Intergenic
1014358232 6:120438557-120438579 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1014534754 6:122601596-122601618 TAGGAGGAAGAGGAAGAGGAGGG - Intronic
1015098209 6:129442670-129442692 GAGGGTGGAGAGCAGGAGGAGGG - Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1015463097 6:133516235-133516257 GAGGGTGAAGGGTAGGAGGAGGG + Intronic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1015675330 6:135739888-135739910 TAGGATGAAGAGCAGAAGGAGGG + Intergenic
1015977648 6:138807069-138807091 GAGGAGGAAGAGAAAGAGGAAGG + Intronic
1016320684 6:142842156-142842178 TGGGTGGAAGGGAAGGAGGAGGG - Intronic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1016714927 6:147214411-147214433 TAAGCTGAGGTGAAGGAGGTAGG + Intronic
1016985356 6:149890772-149890794 CTGGCTGAGGACAAGGAGGAGGG - Intronic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1017589372 6:155961993-155962015 TGGTCTGAGGAGAAGAAGGATGG + Intergenic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1017788340 6:157774426-157774448 GAGGTTGAAGATAAGGAGGGGGG + Intronic
1018036924 6:159889572-159889594 AAGGCAGAAAAGAAGGAGCACGG - Intergenic
1018217368 6:161542037-161542059 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1018220205 6:161570501-161570523 GTGGCTGAGGAGGAGGAGGAGGG - Intronic
1018231907 6:161683165-161683187 GAGGCAGAAGGGAAGGAAGAAGG + Intronic
1018304878 6:162444545-162444567 TAGGAAGAGGAGAAGGAGGGAGG - Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018662859 6:166104652-166104674 AGGGCTGAAGAGAGAGAGGATGG - Intergenic
1018687085 6:166311649-166311671 TAGGCTGAGGAGGAAGCGGAGGG - Intergenic
1018718544 6:166554647-166554669 CAGGCTGCAGTGGAGGAGGATGG - Intronic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019562626 7:1666045-1666067 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1019954977 7:4406074-4406096 TAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1020323410 7:6956632-6956654 GAGGCTCCAGACAAGGAGGAAGG - Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020731139 7:11882442-11882464 AAGGATGGAGAGAAGGAGAAGGG - Intergenic
1020808055 7:12815034-12815056 TAGGCTAAGGAGAAGGTGCATGG + Intergenic
1021121196 7:16797560-16797582 TGGGGAGGAGAGAAGGAGGATGG + Intronic
1021383243 7:19994654-19994676 GAGGATGAAGAGTTGGAGGAGGG - Intergenic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1021622452 7:22562230-22562252 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1021746594 7:23746730-23746752 TAGGCTGAGGAGGAAGAGCATGG + Intronic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1021967249 7:25932784-25932806 TGGGCTGAAGAGAAGGGAGCTGG + Intergenic
1022043001 7:26598112-26598134 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1022145874 7:27539966-27539988 TAGGCTGAGGAGGAAGAGGAGGG + Intronic
1022431424 7:30326278-30326300 GAGGGTGGAGAGTAGGAGGAAGG - Intronic
1022661728 7:32374059-32374081 TAGGCAGGAAAGAGGGAGGAGGG + Intergenic
1022756678 7:33300229-33300251 GAGACTGGAGAGAGGGAGGAAGG - Intronic
1023026337 7:36053849-36053871 TAGGAGGAAGAGGAGGAGGTGGG - Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023046993 7:36218862-36218884 TAGGCTGGTGGGAAGGAGAATGG + Intronic
1023296765 7:38723133-38723155 TAGGCTGAGAAGGAGGAGGAAGG + Exonic
1023326823 7:39069820-39069842 TAGGTTGAGGAGGAGGAGGAAGG + Intronic
1023375476 7:39551205-39551227 TAGGCTGAAGAGGAGGAAGCGGG - Intergenic
1024058702 7:45682650-45682672 TAGGACGGCGAGAAGGAGGATGG - Intronic
1024250908 7:47505122-47505144 TCGGCTGCGGAGTAGGAGGAGGG - Intronic
1024465299 7:49705915-49705937 TACACTGTAGAAAAGGAGGAGGG - Intergenic
1024677254 7:51647779-51647801 TTGGATGAGGAGGAGGAGGAAGG - Intergenic
1024718729 7:52110228-52110250 TAGGCTGAAGGGAAAGATGAAGG + Intergenic
1024816254 7:53275361-53275383 AAGGCTGAAGAGAAGAATGTTGG - Intergenic
1026023738 7:66729467-66729489 GAGGATGGAGAGCAGGAGGAAGG - Intronic
1026176324 7:68000981-68001003 GAGGCTGAGGAGGAGGAGGAAGG + Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026330471 7:69347915-69347937 GAGGATGGAGAGTAGGAGGAGGG + Intergenic
1026354049 7:69541937-69541959 TAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1026388982 7:69880470-69880492 TATGATGATGAGGAGGAGGATGG - Intronic
1026662088 7:72311113-72311135 TAGACTGAAGAGGAGGAGGAGGG - Intronic
1026962832 7:74420054-74420076 AAGGAAGAAGAGAAGGAGGGAGG - Intergenic
1028249357 7:88522781-88522803 CAGGCTGTGGAGAAGGAGCAGGG + Intergenic
1028455789 7:91036568-91036590 TAGGCTGAGGAGGAGGAAGAGGG - Intronic
1028762291 7:94509782-94509804 GAGGCTAAAGAGGAGGAGGAAGG + Exonic
1028889310 7:95969252-95969274 AAGACTGAAGATAAGGAAGATGG + Intronic
1029309641 7:99650730-99650752 GAGGCAGAGGAGAAGGTGGACGG - Intronic
1029351099 7:100013496-100013518 TAAGCTGAGGAGGAAGAGGAAGG - Intergenic
1029501954 7:100936830-100936852 GAGGTAGAAGAGAAGGAGCAGGG - Intergenic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1030021481 7:105279235-105279257 CAGGCAGAAGAGAATGAAGAAGG + Intronic
1030103482 7:105967095-105967117 TGGGGTGAGGGGAAGGAGGAGGG - Intronic
1030133071 7:106219517-106219539 TAGGAGGAAGATTAGGAGGAAGG + Intergenic
1030251602 7:107451583-107451605 GAGGCAGAAGAGATGGAGGGAGG - Intronic
1030270670 7:107665296-107665318 ATGCCCGAAGAGAAGGAGGATGG + Intronic
1031081785 7:117265135-117265157 GAGGCAGGAGAGAGGGAGGAGGG - Intergenic
1031483936 7:122306681-122306703 CAGGCTGAAGAAATGGGGGAGGG + Intronic
1031490406 7:122380907-122380929 TAGCTTGAAGAGAAGGAAAACGG + Intronic
1031834542 7:126667604-126667626 AAAGCTGAGGAGAAGGTGGAAGG + Intronic
1032121232 7:129158534-129158556 TAGAGTGAAGGGTAGGAGGAAGG - Intronic
1032309798 7:130774475-130774497 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1032523366 7:132562349-132562371 GAGGCAGAGGAGGAGGAGGAAGG - Intronic
1032523492 7:132562900-132562922 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1032523622 7:132563428-132563450 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
1032655946 7:133929714-133929736 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1032794934 7:135269614-135269636 GAGGCTGAAGAGCAGTGGGAAGG + Intergenic
1033263628 7:139865738-139865760 GAGGAGGAAGAGGAGGAGGAAGG + Intronic
1033285244 7:140035840-140035862 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033564105 7:142562027-142562049 TGGGCTTTAGAGAAGTAGGAAGG - Intergenic
1033620263 7:143056135-143056157 TAGGATGGAGGGAGGGAGGAGGG + Intergenic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1034081837 7:148286116-148286138 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1034106704 7:148496601-148496623 GAGGCTGAAAAGCAGCAGGAAGG + Intergenic
1034207912 7:149333972-149333994 TAGGTAGGAGAGAAGGTGGATGG - Intergenic
1034238780 7:149593527-149593549 TAGGCTGAGGAGGAGGATGAGGG - Intergenic
1034242212 7:149619294-149619316 TAGACTGAGGAGGAAGAGGAGGG - Intergenic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034565003 7:151906425-151906447 TTGGCAGATGAGAAAGAGGAGGG + Intergenic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1034855785 7:154545428-154545450 AAGGATGAAGAAAAGGAGGGAGG - Intronic
1035060335 7:156064447-156064469 AGTGCTGAAGAGAAGGAGCAAGG - Intergenic
1035389728 7:158496701-158496723 GAGGCTGCAGGGAAGGGGGAGGG - Intronic
1035389770 7:158496796-158496818 GAGGCTGCAGGGAAGGGGGAGGG - Intronic
1035553339 8:545563-545585 AAGGCTGAGGGGAAGGTGGAGGG + Intronic
1035599027 8:884269-884291 GAGGCTGCAGAGAAACAGGAAGG - Intergenic
1035601534 8:899969-899991 AAGGCAGAAGACATGGAGGATGG + Intergenic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036273323 8:7327793-7327815 GAGGCTGAGAAGAAAGAGGAAGG + Intergenic
1036348026 8:7982559-7982581 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036383428 8:8255574-8255596 TAGGCAGTGGAGCAGGAGGAAGG - Intergenic
1036579565 8:10061402-10061424 TAGGTTGGAGAGAAAAAGGATGG - Intronic
1036806434 8:11837545-11837567 TAGACTGTAGAGAGGGAGGTGGG + Intronic
1036843321 8:12143035-12143057 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036864685 8:12385350-12385372 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036962921 8:13265670-13265692 AAGGAAGAAGAGAAGGAAGAAGG - Intronic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037213820 8:16424947-16424969 GAGGAAGAAGAGGAGGAGGAAGG - Intronic
1037439337 8:18898803-18898825 TAAGCTGAAGAGGAGGAGAAAGG + Intronic
1037498445 8:19462966-19462988 CAGGGTGGAGAGTAGGAGGAGGG - Intronic
1037554660 8:20010505-20010527 GAGGCTGAAGGGTAGGAGGAGGG - Intergenic
1037613819 8:20499037-20499059 TAGGCTGAGGAGGAAGATGAGGG - Intergenic
1037987545 8:23299285-23299307 GATGCTGAAGAGAAGCAGAAGGG + Intronic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038483687 8:27918965-27918987 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
1038641685 8:29334022-29334044 TAGGCTGAAGAGCAGGTGACTGG - Exonic
1038711087 8:29946437-29946459 TAGGGAGAGGAGAAGGAGGGAGG - Intergenic
1038798763 8:30731156-30731178 GAGGCTCCAGACAAGGAGGAAGG + Intergenic
1038898287 8:31812556-31812578 GAGGAGGAAGGGAAGGAGGAAGG - Intronic
1039176903 8:34818620-34818642 TCAGCTGAAGAGGAGGAGGAAGG - Intergenic
1039757838 8:40542148-40542170 TAGGTTGCTGAGAAGGAGAATGG + Intronic
1040024645 8:42770565-42770587 AAGGGTGCAGAGCAGGAGGATGG + Intronic
1040071962 8:43195738-43195760 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
1040071969 8:43195764-43195786 GAGGAAGAAGAGGAGGAGGAGGG + Intronic
1040099731 8:43488177-43488199 TAGGCTGAAGAGGAGAAAGAGGG + Intergenic
1040787273 8:51180464-51180486 TAGAGAGAAGATAAGGAGGAAGG - Intergenic
1041191218 8:55356849-55356871 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1041312952 8:56535012-56535034 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041746155 8:61211340-61211362 GAGGGGGAAGAGAAGAAGGAGGG - Intronic
1042154929 8:65834178-65834200 TAGGCTGAGGAGGAAGAGGAGGG - Intronic
1042382297 8:68130962-68130984 TAGGCAGAGGAGAAGGACAAGGG + Intronic
1042701421 8:71618961-71618983 GAGGCTGAAGAGAAAGAGGAGGG - Intergenic
1042847265 8:73180971-73180993 TAGACTGTAGAGAAAGGGGAGGG - Intergenic
1043094184 8:75945783-75945805 TAGGCTGAGGAAGAGGAAGAGGG - Intergenic
1043189177 8:77195405-77195427 GAGGGTGAAGGGTAGGAGGAGGG + Intergenic
1043215925 8:77587900-77587922 AAGGATGAAGAGTAGGATGATGG - Intergenic
1043245960 8:78001768-78001790 TACACAGAAGAAAAGGAGGATGG + Intergenic
1043930282 8:86082674-86082696 AAGGCTGAAAGGCAGGAGGATGG + Intronic
1043962954 8:86438244-86438266 TAGGCTGAGGAGGAGGAAGAGGG + Intronic
1044428608 8:92082889-92082911 GAGGAGGGAGAGAAGGAGGAGGG + Intronic
1044929163 8:97235183-97235205 TAGCCTAGAGAGAAGGAGCAGGG - Intergenic
1044983227 8:97736341-97736363 GAGGGTGAAGGGAAGGGGGAGGG + Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045368897 8:101501477-101501499 AAGGCTGAAGTGAAGGAGAGAGG + Intronic
1045409375 8:101902148-101902170 TAGGCTGAAGAAAAAAAAGAGGG - Intronic
1045474635 8:102542557-102542579 GAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045905273 8:107337732-107337754 GACGCTGCAGAAAAGGAGGACGG - Intronic
1045993265 8:108334683-108334705 TAGGCTGAAGAGGAGGAGGAGGG - Intronic
1046109110 8:109700354-109700376 TTGGCTGAGAAGGAGGAGGAGGG - Intergenic
1046902193 8:119535634-119535656 GAGGCTGGAGAAAAGGGGGAGGG - Intergenic
1047024697 8:120812350-120812372 TGGGCTGGAGAGAAGCGGGACGG - Intronic
1047307934 8:123668309-123668331 TTGGCTGGAGAAAGGGAGGAAGG + Intergenic
1047433284 8:124812028-124812050 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1047541782 8:125774642-125774664 GAGGCTGAATGGCAGGAGGATGG - Intergenic
1047896585 8:129373222-129373244 AAGGCTGCAGTGAGGGAGGAGGG - Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048462384 8:134632148-134632170 TAGGCTGAGGAGAAAGAGGAGGG - Intronic
1048551653 8:135438887-135438909 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048551657 8:135438914-135438936 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1048777217 8:137960407-137960429 GAGGAAGAAGAGAAGGAAGAGGG - Intergenic
1049166596 8:141129432-141129454 GAGGGTGCAGAGATGGAGGAAGG - Intronic
1049253569 8:141602307-141602329 TATGCTGAAGGTAGGGAGGAGGG + Intergenic
1049529502 8:143147331-143147353 GAGTTTGGAGAGAAGGAGGATGG + Intergenic
1049891621 9:74879-74901 GAGGCTGAAGAAAAGAAGAATGG + Intergenic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1049974110 9:845639-845661 GAGGCTGAAGGCAGGGAGGAAGG - Intronic
1050013157 9:1205955-1205977 GAGGCAGTAGAGAGGGAGGAGGG + Intergenic
1050318728 9:4429293-4429315 GAGGCTGGAGAGAGGGAGGTAGG - Intergenic
1050607477 9:7316616-7316638 TAGGTTGATGAGAAGTAGGTGGG + Intergenic
1050684000 9:8146920-8146942 CAGGAAGAAGAGAAGTAGGAAGG - Intergenic
1050753684 9:8973207-8973229 GAGGGAGGAGAGAAGGAGGAGGG - Intronic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051309974 9:15759106-15759128 AAGGCTGGAGAGAGGGAGGGAGG - Intronic
1051489711 9:17647919-17647941 TAGGCTGAGGTGGAAGAGGAAGG - Intronic
1051671628 9:19516300-19516322 CATGATGAAGAGAAGGACGATGG + Exonic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1052043671 9:23769934-23769956 TAGACTGAAGAGAAGGACTTGGG - Intronic
1052559422 9:30065420-30065442 TATGCTGAGGAGGAAGAGGAGGG + Intergenic
1052764827 9:32630391-32630413 TATGATGATGAGGAGGAGGATGG - Exonic
1052785058 9:32820652-32820674 TGGGAAGAAGTGAAGGAGGAGGG - Intergenic
1052819783 9:33129480-33129502 TAGGCAGAAGACCAGGAGTAGGG + Intronic
1053037821 9:34840508-34840530 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1053100533 9:35368202-35368224 GAGGGTGAAGGGTAGGAGGAGGG - Intronic
1053196465 9:36122987-36123009 CAAGCTGAGGGGAAGGAGGAGGG - Exonic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1053470840 9:38345349-38345371 TAGGCAGAAGGGAAGGATGATGG - Intergenic
1053733049 9:41075973-41075995 GAGGCTGAAGAAAAGAAGAATGG + Intergenic
1053789263 9:41674975-41674997 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054177545 9:61886328-61886350 AAGGCAGAGGAGGAGGAGGAAGG - Intergenic
1054659986 9:67694480-67694502 AAGGCAGAGGAGGAGGAGGAAGG + Intergenic
1054695373 9:68355586-68355608 GAGGCTGAAGAAAAGAAGAATGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055266071 9:74497565-74497587 TGGACTGAGGAGGAGGAGGAAGG - Exonic
1055269145 9:74536283-74536305 GATGCTGAAGAAGAGGAGGAGGG + Intronic
1055413758 9:76060457-76060479 TAGGCTGAGGAGGAAGAGGAAGG + Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055782753 9:79837188-79837210 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1055931641 9:81565271-81565293 TATGCTGAAGGGAATGAGGTAGG + Intergenic
1056238314 9:84618048-84618070 TAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1056546836 9:87620542-87620564 AAGGAGGAAGAGAAGGAGTAGGG + Intronic
1056921870 9:90797973-90797995 TAGGCCAAAGGGAAGTAGGATGG + Intergenic
1056983861 9:91342879-91342901 TAGGTTAAGGAGAAAGAGGAGGG - Intronic
1057698320 9:97343337-97343359 TAGGAAGAAGACAAGGAAGAGGG + Exonic
1057752355 9:97803239-97803261 CAGGCGGAAGAGAAGGAGGGAGG + Intergenic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058228740 9:102399214-102399236 TAGGCTGAAGAGGGGGAGTGGGG + Intergenic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059038337 9:110784865-110784887 AAGGAAGAAGAGGAGGAGGAAGG - Exonic
1059174404 9:112155926-112155948 AAGAAGGAAGAGAAGGAGGAAGG + Intronic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059984524 9:119809144-119809166 AAGGCTGAACAGCAGGAGAAAGG - Intergenic
1060504763 9:124189496-124189518 TAGGCTGGGGAGGAGGAGGAGGG + Intergenic
1060610941 9:124963881-124963903 TAGGCTGTGGAGGAGGAGGAGGG + Intronic
1061133535 9:128721200-128721222 TGGGCTGAGGAGGAGGAAGAGGG - Exonic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062540548 9:137040008-137040030 TCGGATGAGGAGAATGAGGACGG - Exonic
1203661785 Un_KI270753v1:51295-51317 TCTGCTGAAGAGAAGTGGGATGG + Intergenic
1203672976 Un_KI270755v1:34344-34366 TCTGCTGAAGAGAAGTGGGATGG + Intergenic
1185661931 X:1735208-1735230 GAGGATGAAGGGGAGGAGGAAGG - Intergenic
1185825255 X:3243377-3243399 TAGGCTCATGTGCAGGAGGAGGG - Intergenic
1186075280 X:5871674-5871696 CAGGCAGAAAAGAAGGAGAAGGG + Intronic
1186239805 X:7554136-7554158 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1186239999 X:7555444-7555466 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1186368770 X:8925372-8925394 TAGGCTGAAGAGGAAGAGGAAGG + Intergenic
1186402589 X:9273567-9273589 AAGGATGAAGAAAAGGAAGAAGG + Intergenic
1186611539 X:11142720-11142742 TTGGCTTAAAAGATGGAGGAAGG + Intronic
1186760606 X:12718199-12718221 GAGGCCGAAGGGAAGGAAGAAGG + Exonic
1187342773 X:18436223-18436245 TAGGCTGAGGAGGAAGAGGGAGG + Intronic
1187452669 X:19412581-19412603 AGGGCTGAAGAGAAAGAGGAAGG + Intronic
1187528939 X:20079278-20079300 GTGGCTGAAGAGAAAGAGCATGG + Intronic
1187547618 X:20267959-20267981 TGGGCGGAGGAGGAGGAGGAGGG + Intergenic
1187607328 X:20899913-20899935 GAGGGTGGAGAGTAGGAGGAGGG - Intergenic
1187678633 X:21743537-21743559 TTGGCTGAAGGGAAGGGAGAAGG + Intronic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188439893 X:30205883-30205905 TTGGATGAAGAAAAGCAGGAAGG + Intergenic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1188799392 X:34508637-34508659 TAGGCTGAAGAGGAGTAGTGAGG - Intergenic
1189018987 X:37315022-37315044 TTTGCTGAAGACAAGGAGGAAGG - Intergenic
1189354036 X:40298181-40298203 TCGGCAGAGGAGGAGGAGGAAGG + Intergenic
1189426862 X:40909677-40909699 GAGGCAGAAGAGAGGGAGGAGGG + Intergenic
1190404597 X:50074036-50074058 GAGGCTGAGGACAAGGAAGATGG + Intronic
1190772286 X:53525406-53525428 TAGGCTGAAGAGGAAGAGGAGGG - Intergenic
1191636085 X:63378803-63378825 TAGGCTGAAGACAAGGACCAAGG - Intergenic
1192093511 X:68185774-68185796 AAGGCTAAAGAAAAGGAGAAAGG + Intronic
1192106008 X:68317648-68317670 GAAGAAGAAGAGAAGGAGGAAGG + Intronic
1192227027 X:69236607-69236629 TTGGCAGAAGTGAGGGAGGAAGG - Intergenic
1192330274 X:70169823-70169845 TAAGCTGGAGGGACGGAGGAGGG + Intergenic
1192461635 X:71322054-71322076 TAGTTTGAAGAGAAAGAGGAAGG + Intergenic
1192477867 X:71459207-71459229 TATGATGATGAGGAGGAGGATGG + Intronic
1193278504 X:79620460-79620482 TGGGCTGCAGAGCAGGAGGTAGG + Intergenic
1194079404 X:89439932-89439954 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1194133010 X:90105668-90105690 TTTGCTGAAGTAAAGGAGGATGG - Intergenic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1194806304 X:98332443-98332465 TAGGGGGCAGAGGAGGAGGAGGG + Intergenic
1195087547 X:101426490-101426512 AAGGCTGAAGAGAATGGAGAAGG + Intronic
1195112827 X:101664657-101664679 TAGGGGGAGGGGAAGGAGGAAGG - Intergenic
1195392859 X:104381217-104381239 TTGGCTGAAGAGGAGTAGGGAGG - Intergenic
1195455505 X:105064763-105064785 TAGGCTGAGGAGGAGGAAAAGGG + Intronic
1195496874 X:105546430-105546452 TAAAATGGAGAGAAGGAGGAAGG + Intronic
1195563652 X:106315931-106315953 GAGGTTGGAGGGAAGGAGGAAGG + Intergenic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1197027271 X:121768577-121768599 GAGGCTGAAGGGAGGGAAGAGGG + Intergenic
1197034020 X:121853535-121853557 TGGGCTGAAGAGAAGGAAGCTGG + Intergenic
1197209169 X:123815257-123815279 CAGGCAGAAGAGAGGGAGGGAGG - Intergenic
1197714640 X:129697573-129697595 TAGGCTGAAGAGATGGGGGAGGG + Intergenic
1198170771 X:134103126-134103148 GAGGTTGGAGAGTAGGAGGAGGG + Intergenic
1198453758 X:136794672-136794694 GAGGATGGAGAGCAGGAGGAGGG - Intergenic
1198570345 X:137948327-137948349 TAGGTTGAAGACAATGAAGAGGG + Intergenic
1198778754 X:140210709-140210731 GAGGGTGAAGCGTAGGAGGAGGG + Intergenic
1199000260 X:142628162-142628184 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
1199095872 X:143737891-143737913 TAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1199498918 X:148487643-148487665 GAGGATGAAGAGGAAGAGGAGGG - Intergenic
1199551464 X:149066078-149066100 TAGGATGAAGGATAGGAGGATGG + Intergenic
1199568972 X:149248098-149248120 TAGGCTGAGGAGGAGGAAGAGGG + Intergenic
1199715564 X:150505326-150505348 TAGGGTGAAGGGATGGAGGGTGG - Intronic
1199770382 X:150971490-150971512 AAGGGTGGAGAGCAGGAGGAGGG + Intergenic
1199860603 X:151797724-151797746 TAGGCTGAAGAGAAGTAGACTGG - Intergenic
1199896898 X:152135442-152135464 GAGGAGGAAGAGGAGGAGGAGGG + Exonic
1199964000 X:152803285-152803307 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1200002335 X:153068512-153068534 TAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1200005389 X:153081498-153081520 TAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1200066725 X:153507520-153507542 TAGGCTGACGAGGGGGAGCAGGG + Intronic
1200432022 Y:3095237-3095259 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1201184011 Y:11380298-11380320 TAGGGGGAAGAGTAGGAGGAGGG + Intergenic
1201219148 Y:11749805-11749827 TAGGCTGAAGAGAAAGAGATAGG + Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201388577 Y:13471252-13471274 TAAGCTGAAGGAAAGGAGCAAGG + Intronic
1201474385 Y:14364718-14364740 AAGGAGGAAGAGAAGGAGCATGG + Intergenic
1201710941 Y:16990914-16990936 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1201741108 Y:17325485-17325507 TAGGAAGAAGGGAAGAAGGAGGG + Intergenic