ID: 994501883

View in Genome Browser
Species Human (GRCh38)
Location 5:100589374-100589396
Sequence GCACCTCATCAGATTCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994501881_994501883 -10 Left 994501881 5:100589361-100589383 CCTTGGGCTGCCTGCACCTCATC No data
Right 994501883 5:100589374-100589396 GCACCTCATCAGATTCTAGCTGG No data
994501880_994501883 -9 Left 994501880 5:100589360-100589382 CCCTTGGGCTGCCTGCACCTCAT No data
Right 994501883 5:100589374-100589396 GCACCTCATCAGATTCTAGCTGG No data
994501877_994501883 10 Left 994501877 5:100589341-100589363 CCACTGCTATGAAAACAAACCCT No data
Right 994501883 5:100589374-100589396 GCACCTCATCAGATTCTAGCTGG No data
994501876_994501883 11 Left 994501876 5:100589340-100589362 CCCACTGCTATGAAAACAAACCC No data
Right 994501883 5:100589374-100589396 GCACCTCATCAGATTCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994501883 Original CRISPR GCACCTCATCAGATTCTAGC TGG Intergenic
No off target data available for this crispr