ID: 994502181

View in Genome Browser
Species Human (GRCh38)
Location 5:100593083-100593105
Sequence CTTTTTAAGCACTGGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994502173_994502181 27 Left 994502173 5:100593033-100593055 CCCAGAACTAAATCTAAACTCAT No data
Right 994502181 5:100593083-100593105 CTTTTTAAGCACTGGGTGCCTGG No data
994502174_994502181 26 Left 994502174 5:100593034-100593056 CCAGAACTAAATCTAAACTCATC No data
Right 994502181 5:100593083-100593105 CTTTTTAAGCACTGGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994502181 Original CRISPR CTTTTTAAGCACTGGGTGCC TGG Intergenic
No off target data available for this crispr