ID: 994507602

View in Genome Browser
Species Human (GRCh38)
Location 5:100662348-100662370
Sequence CTGTTAGCTGCCACTCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994507598_994507602 14 Left 994507598 5:100662311-100662333 CCAATGCATTTAGGAATGATTTT No data
Right 994507602 5:100662348-100662370 CTGTTAGCTGCCACTCTGAAGGG No data
994507597_994507602 15 Left 994507597 5:100662310-100662332 CCCAATGCATTTAGGAATGATTT No data
Right 994507602 5:100662348-100662370 CTGTTAGCTGCCACTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994507602 Original CRISPR CTGTTAGCTGCCACTCTGAA GGG Intergenic
No off target data available for this crispr