ID: 994508936

View in Genome Browser
Species Human (GRCh38)
Location 5:100678695-100678717
Sequence TCTCATCTAAAGATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994508931_994508936 14 Left 994508931 5:100678658-100678680 CCAAAGTCATCTTTTGATATACT No data
Right 994508936 5:100678695-100678717 TCTCATCTAAAGATGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994508936 Original CRISPR TCTCATCTAAAGATGGAGCT TGG Intergenic
No off target data available for this crispr