ID: 994509403

View in Genome Browser
Species Human (GRCh38)
Location 5:100684692-100684714
Sequence TTGTGGTTCTTGTGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994509403_994509416 28 Left 994509403 5:100684692-100684714 CCTTTTTCCCACAAGAACCACAA No data
Right 994509416 5:100684743-100684765 TAGGATAGACAATATAGCAGAGG No data
994509403_994509412 9 Left 994509403 5:100684692-100684714 CCTTTTTCCCACAAGAACCACAA No data
Right 994509412 5:100684724-100684746 CAACTTTGAGCCCATCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994509403 Original CRISPR TTGTGGTTCTTGTGGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr