ID: 994513031

View in Genome Browser
Species Human (GRCh38)
Location 5:100731981-100732003
Sequence GTGTTTAAACAGAAAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994513027_994513031 13 Left 994513027 5:100731945-100731967 CCTTTCTAACTGATCTGGCTGCT No data
Right 994513031 5:100731981-100732003 GTGTTTAAACAGAAAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994513031 Original CRISPR GTGTTTAAACAGAAAGTGCA AGG Intergenic
No off target data available for this crispr