ID: 994515979

View in Genome Browser
Species Human (GRCh38)
Location 5:100773470-100773492
Sequence TGTTAGGACCATATCTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994515972_994515979 -4 Left 994515972 5:100773451-100773473 CCTCTCTGGGATCCACTTATGTT No data
Right 994515979 5:100773470-100773492 TGTTAGGACCATATCTTGGGGGG No data
994515971_994515979 1 Left 994515971 5:100773446-100773468 CCAGACCTCTCTGGGATCCACTT No data
Right 994515979 5:100773470-100773492 TGTTAGGACCATATCTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994515979 Original CRISPR TGTTAGGACCATATCTTGGG GGG Intergenic
No off target data available for this crispr