ID: 994516306 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:100776656-100776678 |
| Sequence | CCTCACATAGTGAAGAGAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 994516306_994516311 | 17 | Left | 994516306 | 5:100776656-100776678 | CCCTCTCTCTTCACTATGTGAGG | No data | ||
| Right | 994516311 | 5:100776696-100776718 | TCATCTGAAAATCAGGAAGAAGG | No data | ||||
| 994516306_994516310 | 10 | Left | 994516306 | 5:100776656-100776678 | CCCTCTCTCTTCACTATGTGAGG | No data | ||
| Right | 994516310 | 5:100776689-100776711 | AAATCAGTCATCTGAAAATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 994516306 | Original CRISPR | CCTCACATAGTGAAGAGAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||