ID: 994516306

View in Genome Browser
Species Human (GRCh38)
Location 5:100776656-100776678
Sequence CCTCACATAGTGAAGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994516306_994516311 17 Left 994516306 5:100776656-100776678 CCCTCTCTCTTCACTATGTGAGG No data
Right 994516311 5:100776696-100776718 TCATCTGAAAATCAGGAAGAAGG No data
994516306_994516310 10 Left 994516306 5:100776656-100776678 CCCTCTCTCTTCACTATGTGAGG No data
Right 994516310 5:100776689-100776711 AAATCAGTCATCTGAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994516306 Original CRISPR CCTCACATAGTGAAGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr