ID: 994517807

View in Genome Browser
Species Human (GRCh38)
Location 5:100793453-100793475
Sequence CTAGATGGTCACATAGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994517807_994517810 5 Left 994517807 5:100793453-100793475 CCAATATCTATGTGACCATCTAG No data
Right 994517810 5:100793481-100793503 TTTTTTCCCACAGTCAGAACTGG No data
994517807_994517811 6 Left 994517807 5:100793453-100793475 CCAATATCTATGTGACCATCTAG No data
Right 994517811 5:100793482-100793504 TTTTTCCCACAGTCAGAACTGGG No data
994517807_994517812 7 Left 994517807 5:100793453-100793475 CCAATATCTATGTGACCATCTAG No data
Right 994517812 5:100793483-100793505 TTTTCCCACAGTCAGAACTGGGG No data
994517807_994517815 19 Left 994517807 5:100793453-100793475 CCAATATCTATGTGACCATCTAG No data
Right 994517815 5:100793495-100793517 CAGAACTGGGGTTTGCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994517807 Original CRISPR CTAGATGGTCACATAGATAT TGG (reversed) Intergenic
No off target data available for this crispr