ID: 994517811

View in Genome Browser
Species Human (GRCh38)
Location 5:100793482-100793504
Sequence TTTTTCCCACAGTCAGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994517809_994517811 -9 Left 994517809 5:100793468-100793490 CCATCTAGGTATTTTTTTTCCCA No data
Right 994517811 5:100793482-100793504 TTTTTCCCACAGTCAGAACTGGG No data
994517807_994517811 6 Left 994517807 5:100793453-100793475 CCAATATCTATGTGACCATCTAG No data
Right 994517811 5:100793482-100793504 TTTTTCCCACAGTCAGAACTGGG No data
994517806_994517811 7 Left 994517806 5:100793452-100793474 CCCAATATCTATGTGACCATCTA No data
Right 994517811 5:100793482-100793504 TTTTTCCCACAGTCAGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994517811 Original CRISPR TTTTTCCCACAGTCAGAACT GGG Intergenic
No off target data available for this crispr