ID: 994517815

View in Genome Browser
Species Human (GRCh38)
Location 5:100793495-100793517
Sequence CAGAACTGGGGTTTGCCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994517807_994517815 19 Left 994517807 5:100793453-100793475 CCAATATCTATGTGACCATCTAG No data
Right 994517815 5:100793495-100793517 CAGAACTGGGGTTTGCCAACTGG No data
994517809_994517815 4 Left 994517809 5:100793468-100793490 CCATCTAGGTATTTTTTTTCCCA No data
Right 994517815 5:100793495-100793517 CAGAACTGGGGTTTGCCAACTGG No data
994517806_994517815 20 Left 994517806 5:100793452-100793474 CCCAATATCTATGTGACCATCTA No data
Right 994517815 5:100793495-100793517 CAGAACTGGGGTTTGCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994517815 Original CRISPR CAGAACTGGGGTTTGCCAAC TGG Intergenic
No off target data available for this crispr