ID: 994520603

View in Genome Browser
Species Human (GRCh38)
Location 5:100829450-100829472
Sequence CTAAAATAGAATTCAGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994520603_994520606 29 Left 994520603 5:100829450-100829472 CCTTTGCCTGAATTCTATTTTAG 0: 1
1: 0
2: 2
3: 23
4: 351
Right 994520606 5:100829502-100829524 GACAGTGATATATCTATAATAGG 0: 1
1: 0
2: 0
3: 8
4: 141
994520603_994520607 30 Left 994520603 5:100829450-100829472 CCTTTGCCTGAATTCTATTTTAG 0: 1
1: 0
2: 2
3: 23
4: 351
Right 994520607 5:100829503-100829525 ACAGTGATATATCTATAATAGGG No data
994520603_994520605 1 Left 994520603 5:100829450-100829472 CCTTTGCCTGAATTCTATTTTAG 0: 1
1: 0
2: 2
3: 23
4: 351
Right 994520605 5:100829474-100829496 GTAATAAAGATTGAAACAATAGG 0: 1
1: 0
2: 4
3: 50
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994520603 Original CRISPR CTAAAATAGAATTCAGGCAA AGG (reversed) Intronic
904839949 1:33366002-33366024 CTAAAATAGAATTTATGAAGTGG + Intronic
907886091 1:58593551-58593573 CTAAAATTGAATTTAGGCAAGGG + Intergenic
907950761 1:59181381-59181403 GTACAATGGCATTCAGGCAATGG - Intergenic
909842267 1:80343031-80343053 CTGAATTAGAATTGAGGTAATGG + Intergenic
910658899 1:89649177-89649199 CTAAAATAAAATCCATGCTAAGG + Intronic
911743460 1:101412872-101412894 CTCACATAAAATTAAGGCAAAGG + Intergenic
911816736 1:102361955-102361977 CTAAAATAAAATAGAAGCAACGG + Intergenic
912579158 1:110704675-110704697 CTAACATAGAGTTCAGGCCATGG - Intergenic
912998778 1:114558980-114559002 CTTAAATTGAATTCTGTCAATGG - Intergenic
913164915 1:116176314-116176336 CTAAAACAGAATTGAGGTCAGGG + Intergenic
913241246 1:116831641-116831663 TTAAAAAAGAATTAAGACAATGG - Intergenic
915113527 1:153580402-153580424 TTAAAATAGAATAAATGCAATGG + Intergenic
916621021 1:166497502-166497524 CTGAAAAAGAATTCAGAAAAAGG + Intergenic
917258957 1:173147153-173147175 CAAAAATAGAATTCAGAATATGG - Intergenic
918899425 1:190393957-190393979 GTTAAATAGTTTTCAGGCAAAGG - Intronic
920583615 1:207136517-207136539 CTAAATTAGGATTCAGGGCATGG - Intronic
921282286 1:213578722-213578744 ATACAATAGGATACAGGCAATGG - Intergenic
921374801 1:214462670-214462692 CTAAAATAGAATGCAGGGGTAGG - Intronic
921668649 1:217902503-217902525 TTAAAAAAGCATTTAGGCAAAGG - Intergenic
921800575 1:219398530-219398552 CCAAAATAGAATTCAGAATATGG - Intergenic
921908828 1:220526675-220526697 CTCAAACAGAATTTAGGCAGCGG - Intergenic
924016636 1:239733070-239733092 ATAAAATGGCATTTAGGCAATGG - Intronic
924458522 1:244237613-244237635 CATAAACAGTATTCAGGCAATGG + Intergenic
1063341847 10:5273126-5273148 CTAGATTATACTTCAGGCAATGG - Intergenic
1063599257 10:7465088-7465110 GTAAAAGAGAATTGAGGAAAAGG + Intergenic
1064233592 10:13552173-13552195 ACAAAATAGAATTCAAGAAAAGG + Intergenic
1064675030 10:17751846-17751868 ATAAAAGCAAATTCAGGCAAAGG - Intergenic
1064852150 10:19720618-19720640 GGAAAATAGAATTGAGGCAAAGG - Intronic
1065013676 10:21442178-21442200 CAAAAATAAAATTTAGGCCAGGG + Intergenic
1065748731 10:28865543-28865565 TTTAAATAGAAATCAGGGAATGG + Intronic
1067400048 10:45964088-45964110 CTGACATTGAATTCAGGAAACGG - Intergenic
1067845209 10:49714525-49714547 CAAATATAGAATTGAGGAAAGGG + Intergenic
1068666411 10:59680183-59680205 CAAACAAAGAATTCAAGCAAGGG + Intronic
1069722077 10:70556128-70556150 ATAAAATAGAACCCAAGCAAAGG + Intronic
1069724437 10:70568093-70568115 CTGCAAAAGAATTCAGCCAAGGG - Exonic
1070428543 10:76313588-76313610 CTAAAGTATGTTTCAGGCAATGG - Intronic
1071191863 10:83109947-83109969 CAAAAATAGAATTCACGACATGG + Intergenic
1071882048 10:89910368-89910390 CAGAAATAGAATTCAGGATACGG - Intergenic
1072076626 10:91981444-91981466 CTAAAAAAAAAGTCATGCAAAGG - Intronic
1074215219 10:111377512-111377534 GAAAAATTGATTTCAGGCAAAGG + Intergenic
1074965825 10:118490042-118490064 CCAAAATAGAGCTCAGGCCATGG + Intergenic
1077709140 11:4518312-4518334 CCATATTAGAATTCAGGGAAGGG - Intergenic
1077720664 11:4625359-4625381 CGAAAATAGAATGCAGGCCCAGG - Intergenic
1079500267 11:21094692-21094714 CCAACATAGAGTTCAGGCCATGG - Intronic
1079700572 11:23541205-23541227 CTAGAATAGAATTCAGTAAAAGG - Intergenic
1079714086 11:23722475-23722497 ATAAAAGAGACTTCAGGGAAAGG + Intergenic
1080082886 11:28241704-28241726 AGAAGATAGCATTCAGGCAAAGG + Intronic
1081083369 11:38769833-38769855 CTGAAATAGAATTAAGACGATGG + Intergenic
1081343814 11:41957888-41957910 CAGAAATAGAATTCAGGATATGG + Intergenic
1081681182 11:45004897-45004919 CTAAAATTGTATTGTGGCAATGG - Intergenic
1086231538 11:84576594-84576616 CCAAAAGACAATTCAGGCAGAGG + Intronic
1086431175 11:86738586-86738608 CTAGAATAGGATTCTGGGAAGGG + Intergenic
1086617236 11:88836320-88836342 CAAAAATAGAATTCAGCTGATGG + Intronic
1088973463 11:114793948-114793970 GTAAAGTGGGATTCAGGCAAAGG - Intergenic
1089530843 11:119128170-119128192 CTAAAACATAAGTCAGACAAAGG - Intronic
1090696415 11:129247855-129247877 ATAAAATGAAATTCAGTCAATGG + Intronic
1091982740 12:4879582-4879604 CCAATGTAGAATTCAGGCCATGG - Intergenic
1092513666 12:9185094-9185116 CAGAAATAGAATTCAGACTATGG + Intronic
1092652391 12:10648158-10648180 ATCAAATGGAATTTAGGCAATGG + Intronic
1093528621 12:20135185-20135207 CAGAAATAGAATTCAGACTATGG - Intergenic
1095039691 12:37427387-37427409 CCAACATAGAACTCAGGCCATGG + Intergenic
1095139231 12:38641361-38641383 CTAAAATACAAATTAGGCTAAGG + Intergenic
1096146106 12:49279986-49280008 TTAAAAAAGAACTCAGGGAAAGG + Intergenic
1097623663 12:61973126-61973148 CAAAAATAGATTACAGGCACTGG + Intronic
1097629471 12:62042526-62042548 CTAGAACAGAATTCAGGGCAAGG - Intronic
1098179126 12:67827225-67827247 GGAGAATAGAATCCAGGCAATGG - Intergenic
1100885385 12:99064333-99064355 GTAAAATAGAAGTGAAGCAATGG + Intronic
1101008714 12:100427936-100427958 CTAGACTAGGATTCAGGGAATGG + Intergenic
1102861158 12:116337669-116337691 CTAAAATGTAATTCTAGCAAGGG + Intergenic
1105703551 13:22952185-22952207 CAAAAAAACAATTCATGCAAAGG + Intergenic
1106899654 13:34341703-34341725 ATAAGATATAAATCAGGCAAGGG + Intergenic
1107768727 13:43766587-43766609 CTAAAAATGTATTCAGGGAACGG + Intronic
1108663227 13:52605098-52605120 CTAACATAGATTTCAGTGAATGG - Intergenic
1108775732 13:53762605-53762627 CCAAAATAGAATTCAGAATATGG + Intergenic
1108795461 13:54024495-54024517 CCGAAATAGAATTCAGGATATGG + Intergenic
1109185205 13:59259935-59259957 GTCAAATAGGATTCAGTCAATGG - Intergenic
1109621424 13:64911927-64911949 CAGAAATAGAATTCAGACTATGG + Intergenic
1109779022 13:67083028-67083050 CTAAAATAAAATTAATGGAAAGG + Intronic
1110963801 13:81665483-81665505 TTAAAATAGGATTCTGGCAATGG - Intergenic
1111147282 13:84199766-84199788 CCTAATTAGAATTCAAGCAAAGG + Intergenic
1111353979 13:87073284-87073306 CTTAAATACAGTTCAGACAAAGG - Intergenic
1111998246 13:95186250-95186272 ATAAAATACAATTGAGGCCAAGG + Intronic
1115209247 14:30948765-30948787 CTAAATTGTAAATCAGGCAATGG + Intronic
1115328531 14:32168565-32168587 TGGAACTAGAATTCAGGCAATGG + Intergenic
1117278507 14:54213964-54213986 CTAAAAGAAAATTAATGCAATGG + Intergenic
1121359076 14:93239416-93239438 ATAAAATAAAATTTAGGCCATGG - Exonic
1124181454 15:27479443-27479465 CTAAAATAAAGTACAGGCACAGG - Intronic
1124388194 15:29227235-29227257 TTAAAATGGAATTCAGCCAGGGG + Intronic
1124622520 15:31282364-31282386 ATAAAATAGACTTCAGTAAAAGG - Intergenic
1125207657 15:37173002-37173024 TTAAAAAAAAATTCAGGCCATGG - Intergenic
1125425353 15:39543185-39543207 CTAAAATAGAACTTAGGAGATGG + Intergenic
1127107196 15:55629299-55629321 CTAAAATAGAATTACAGAAAAGG - Intronic
1128824676 15:70702358-70702380 CTAAAGTAGAACTCAACCAATGG - Intronic
1128852595 15:70975073-70975095 GAAAAAGAGAATTCAGACAATGG + Intronic
1128968469 15:72085599-72085621 CAGAAATAGAATTCAGACAATGG - Intronic
1129969641 15:79766754-79766776 CTGAAATAAAATCCAGGGAAAGG - Intergenic
1130053675 15:80504779-80504801 AAAAAATGGAAATCAGGCAAAGG + Intronic
1130244564 15:82233314-82233336 TTAAAATAGAATTCAAGAATGGG - Intronic
1130690416 15:86077432-86077454 TTAAGATAGAATTCAGGAGAGGG + Intergenic
1132437435 15:101820348-101820370 ATAAAATAGAATTGAATCAAGGG - Intergenic
1133656543 16:7870548-7870570 ATAAAATAGAATTAAAGCACAGG - Intergenic
1134892139 16:17850694-17850716 CTCGCTTAGAATTCAGGCAAAGG + Intergenic
1136226719 16:28864775-28864797 CTAAAATAGAAATTAGAGAAAGG - Intronic
1139133851 16:64178255-64178277 CTAATGTAGAACTCAGGCCATGG + Intergenic
1140275145 16:73502344-73502366 CAAAAAGAGAATGTAGGCAATGG - Intergenic
1141586598 16:85037988-85038010 CCAAAATCGAATTCAGGTCATGG + Intronic
1145342312 17:21965526-21965548 CTCAAATAGAATTGACTCAAAGG + Intergenic
1145378181 17:22371062-22371084 CCAACATAGAACTCAGGCCATGG - Intergenic
1149763718 17:59256485-59256507 TAAAAATAACATTCAGGCAAGGG - Intronic
1150935206 17:69627767-69627789 CCCAATTTGAATTCAGGCAAAGG + Intergenic
1151114236 17:71715974-71715996 TAAAAATAGAATTAAGTCAATGG - Intergenic
1153350135 18:4070650-4070672 ATAAAATAGAATTCATGGCAAGG + Intronic
1153550326 18:6256273-6256295 TTAAAATATAATTCAGGCATAGG + Intronic
1155328198 18:24687477-24687499 ATAAAATAAAATCCAGCCAATGG - Intergenic
1156010685 18:32494117-32494139 TTAAAATAGAATTCTGGGATTGG + Intergenic
1156758663 18:40559694-40559716 ATAAAATATCATGCAGGCAATGG - Intergenic
1157447658 18:47757391-47757413 AAAAAAAAGAATTCAGGAAAAGG + Intergenic
1157899501 18:51500947-51500969 CTACAGTTGAATTCAGCCAATGG + Intergenic
1158235109 18:55303546-55303568 CTAACAAAGAATTCTGGAAAAGG - Intronic
1158244439 18:55415107-55415129 CTCAAATACAATCAAGGCAAGGG + Intronic
1158524301 18:58198437-58198459 CTAAAACAAAATTCGGGCCAGGG - Intronic
1158905619 18:62008586-62008608 CTTAACTGGAATTGAGGCAAAGG - Intergenic
1159018307 18:63120910-63120932 CTGAAATAGAATTCTGACACAGG + Intergenic
1159106709 18:64010214-64010236 CTAAAATAGAAATTAGAGAACGG + Intergenic
1159235053 18:65660466-65660488 CGAAAATGGGATTCAGGAAATGG - Intergenic
1159500223 18:69259246-69259268 CTAGATAAGAATTCAGGGAAAGG - Intergenic
1159572641 18:70136239-70136261 TTAAATTTGAAATCAGGCAAAGG - Intronic
1160097920 18:75892074-75892096 ATGAAATAGGATTCAGGCATTGG + Intergenic
1160430514 18:78808653-78808675 CTATAATAAAATTGAGGCAAAGG - Intergenic
1162231670 19:9271463-9271485 CAAGACAAGAATTCAGGCAAAGG + Intergenic
1162970806 19:14180249-14180271 AACAAATAGAAGTCAGGCAAGGG - Intronic
1165974790 19:39666192-39666214 CCAACATAGAACTCAGGCCATGG - Intergenic
1166487962 19:43230026-43230048 CTGAAAAAGAATTCAGGACATGG + Intronic
924963943 2:58414-58436 CTGGACAAGAATTCAGGCAAAGG + Intergenic
925843307 2:8012489-8012511 CTAAAATGGAATTCTGGAACTGG + Intergenic
925857470 2:8144061-8144083 TTAAAATAGTACTCAGCCAAGGG - Intergenic
927106048 2:19827004-19827026 ATAAAATAGACTTCAAGAAAAGG + Intergenic
927229026 2:20801745-20801767 CTAAAAGAGAATTCTAGCAGAGG - Intronic
928274798 2:29890779-29890801 ATAACACAGAATTGAGGCAAGGG - Intronic
928363183 2:30681796-30681818 CTAAACTAGAAGACAGCCAAGGG - Intergenic
930281846 2:49378662-49378684 TTAAAATAAAATTCAGTGAAAGG - Intergenic
931304437 2:61015000-61015022 CTGAATTAGAATTCAGCCAGAGG - Intronic
931309859 2:61067389-61067411 CTAAAATGGAATTCAGGGCAAGG - Intronic
933185402 2:79272766-79272788 CAAAAACAGAATTCAGCCATTGG - Intronic
933827164 2:86172631-86172653 CTAAAATAAAATTCTTACAATGG + Intronic
934040376 2:88123339-88123361 GTAGAAAAGAATTCAGTCAAAGG - Intronic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
935069533 2:99681892-99681914 AAAAAATAGAATTAAGGCAGTGG - Intronic
935134313 2:100286119-100286141 AAAAAAAAGAATTCAGGCAGGGG + Intronic
935386593 2:102505744-102505766 TTTAAATATAATTCAGTCAATGG + Intronic
935451261 2:103212249-103212271 CTAGAATAGAATATAGGGAAAGG - Intergenic
936812158 2:116414591-116414613 CAAAAATAGAATTCAGAATATGG + Intergenic
939274975 2:139989415-139989437 CAAAAATAGAATTCAGAATATGG - Intergenic
939484505 2:142793414-142793436 CTAAAATAGATTTGTGGCAGTGG - Intergenic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
939662679 2:144909869-144909891 TTAAAAGATAACTCAGGCAATGG - Intergenic
939767429 2:146268391-146268413 CTAAAAAATAAATGAGGCAAAGG + Intergenic
939804603 2:146757834-146757856 TTAAAATAGAATTTTCGCAAAGG - Intergenic
940378544 2:152986785-152986807 CTAAAACAGAAATCTGGGAAAGG - Intergenic
940542999 2:155045936-155045958 CTAACATAGAGCTCAGGCCATGG - Intergenic
940548573 2:155121740-155121762 CTAAAGTAAAACTTAGGCAATGG + Intergenic
940895289 2:159075792-159075814 CTAAAATAAAATTCATACAAAGG - Intronic
941633218 2:167907224-167907246 ATGAAATAGAATTGTGGCAAAGG + Intergenic
942073773 2:172338463-172338485 CTAAAATAAAGGTAAGGCAAGGG + Intergenic
942804115 2:179909807-179909829 AAAAAATAAAATTCTGGCAATGG + Intergenic
943461760 2:188177815-188177837 ATAAAACAGAATTTAAGCAAGGG + Intergenic
945018598 2:205547804-205547826 GGAAAATAGAATTGAGGCAGTGG - Intronic
946907468 2:224430439-224430461 CTCAAGCAGAATGCAGGCAAGGG - Intergenic
947413324 2:229866879-229866901 CAAAAGCAGAATACAGGCAAAGG + Intronic
948422160 2:237866340-237866362 CTAAAATAAAAAACAGGCACAGG - Intronic
948762396 2:240200011-240200033 CACTAATAGAATTCAAGCAATGG + Intergenic
1169529894 20:6473852-6473874 CTAAATTACACTTCAGTCAATGG - Intergenic
1170184361 20:13571661-13571683 GTAAAATACAAGTCAGGTAATGG + Intronic
1170849048 20:19987147-19987169 CTACAATGAAATTCAGACAATGG - Intronic
1171179053 20:23078040-23078062 GTCAAATATAATTCAGGGAAAGG + Intergenic
1171525095 20:25802944-25802966 CCAACATAGAACTCAGGCCATGG + Intronic
1171551732 20:26052940-26052962 CCAACATAGAACTCAGGCCATGG - Intergenic
1173340902 20:42151907-42151929 GTAAAATAGCATTTAGGGAATGG + Intronic
1173451038 20:43164167-43164189 TGAAAATACAATTCATGCAAAGG + Intronic
1173928428 20:46798363-46798385 CTAAAATAGAAATCAGATCAGGG + Intergenic
1174637597 20:52015100-52015122 TTACAAGAGAATTCAGTCAAGGG - Intergenic
1175528225 20:59651579-59651601 GTAAAATAGCACACAGGCAATGG + Intronic
1176614278 21:9015538-9015560 CAAAAGTAGAATTCTGGCAAAGG + Intergenic
1176702373 21:10071142-10071164 CTTAAATAGCATTTAGGCATGGG + Intergenic
1176969506 21:15249418-15249440 CTGAGATAGAATTCAGGGAAAGG + Intergenic
1178155127 21:29844159-29844181 ATAAAATAAAATTAAGCCAAAGG - Intronic
1178335840 21:31742351-31742373 GTAAAAGAGAATTCAGGGCAAGG - Intergenic
1180573650 22:16752498-16752520 CCAATATAGAACTCAGGCCATGG + Intergenic
1182815860 22:33162731-33162753 CTAAAATTGAATTGTGGCAGTGG + Intronic
1182917174 22:34045041-34045063 ATAAAGTAGAATTCAGAAAATGG - Intergenic
1183863220 22:40684221-40684243 CTAAAATAGATTTCAAGTTACGG - Intergenic
1184053522 22:42027228-42027250 CTAAAATTGAAGTCAGGATAAGG + Exonic
1184417664 22:44361650-44361672 CTAAGTTAGAATGCAGTCAATGG + Intergenic
1184450939 22:44582373-44582395 CCTAAATAGACTTCAGGCACAGG + Intergenic
950838142 3:15940348-15940370 TTAGAATAGAAGTCAGACAAGGG + Intergenic
950918853 3:16672268-16672290 AGAAAACAGAATTCAGTCAACGG - Intergenic
953141403 3:40232435-40232457 CTAAAATAGAATTCACTCGGAGG + Intronic
953669193 3:44948308-44948330 CTATAAAAGAATTCTGGGAAGGG + Intronic
954729627 3:52648412-52648434 CTACAAAAGTATTCATGCAATGG - Exonic
956590521 3:70909480-70909502 CAGAAATAGCATTCAGGCAGAGG - Intergenic
957255600 3:77832455-77832477 CTGCAAGAGAATTCAAGCAAAGG - Intergenic
957361446 3:79164626-79164648 TTAAAATAGAATTCAGGTCCTGG + Intronic
957935963 3:86943128-86943150 CTAAACTAGAATTTAGAGAATGG + Exonic
957939407 3:86986751-86986773 CTAAAATAAAATACAGGAAGTGG - Intronic
958148373 3:89657400-89657422 CTGAAATAGAATTCAGAATATGG - Intergenic
958574985 3:95937172-95937194 AGAAAAAATAATTCAGGCAAAGG + Intergenic
959326933 3:104948725-104948747 TTATAAAATAATTCAGGCAAAGG + Intergenic
960985677 3:123279099-123279121 CTAAATTAGAAATCGGTCAAGGG + Intergenic
962667564 3:137670453-137670475 GTAGAAAAGAATTCAGGAAAAGG + Intergenic
962977542 3:140458660-140458682 CTATAATAGTACTCAGGCTAAGG - Intronic
963774960 3:149429326-149429348 CTTAAATAGAATTAAGAAAAGGG + Intergenic
963803040 3:149696393-149696415 CTAAAAGAGAATTCCTGTAAAGG - Intronic
963804325 3:149707954-149707976 CTAAACTAGAATTATGGTAATGG + Intronic
964392852 3:156215466-156215488 CTAAAGTAGAGGTCAGGCAGAGG + Intronic
964698226 3:159534175-159534197 TTACAGTAGAATTCAAGCAAGGG + Intronic
965037231 3:163455225-163455247 CTAAAATAGAATGAGGGAAATGG - Intergenic
965198632 3:165629435-165629457 CTAACATAGAGCTCAGGCCATGG - Intergenic
966271613 3:178114484-178114506 CTAAAATATAATTAAAGCAATGG + Intergenic
966407575 3:179613929-179613951 CTAACATAGATTTCAGGAGAGGG + Intronic
966630190 3:182064335-182064357 CTAAAAAAAAACTCAGGCCAAGG - Intergenic
966794871 3:183703803-183703825 TCAAAATAGAATTCAGGAAATGG + Intronic
967272702 3:187744131-187744153 ATAAAATAAAATTTAGGAAAGGG + Intronic
969861411 4:10038602-10038624 TTAAAATAGATTTCAATCAATGG + Intronic
969965259 4:10987386-10987408 CTAACAGAGAATTCAAGGAATGG - Intergenic
970596171 4:17602463-17602485 TAAAAATAGAAGTCAGCCAATGG + Intronic
972100338 4:35407581-35407603 CCAACATAGAGCTCAGGCAATGG + Intergenic
972269956 4:37501733-37501755 CAGAAATAGAATTCAGGATATGG - Intronic
973334316 4:48940844-48940866 CTGAAACAGGATTCAGGAAAGGG - Intergenic
974455848 4:62128516-62128538 CCAACATAGAATTCGGGCTATGG + Intergenic
975404225 4:73970218-73970240 CAAAAATAGAATTCAGATTATGG + Intergenic
976525288 4:86080479-86080501 CTAAACTATATTTCAGGTAAGGG + Intronic
977035816 4:91951737-91951759 ATAAAATAGGAATCAGGAAAGGG + Intergenic
977743036 4:100509782-100509804 CTAAAATAGAAATGATACAATGG + Intronic
978952780 4:114581508-114581530 CAAAAATAGAATTCAGAATATGG - Intergenic
979158443 4:117428662-117428684 CAGAAATAGAATTCAGACTAAGG - Intergenic
979195682 4:117917283-117917305 CCAAAATATAATTCAAGCAGTGG - Intergenic
980257509 4:130401873-130401895 CTGAAATAGAATTCAGAATATGG - Intergenic
980374545 4:131927556-131927578 CTTAAATAGCATTTAGGCATGGG + Intergenic
981306547 4:143252801-143252823 CTAAAATATATTTAAAGCAAGGG + Intergenic
982593317 4:157344892-157344914 CTAAAATAGAATTCAGAATTTGG + Intronic
983114747 4:163800262-163800284 CTAAAATAAAAATCAGAAAAAGG + Intronic
983343448 4:166496710-166496732 GTAAAATGGAATTTAGTCAATGG + Intergenic
983806021 4:171993137-171993159 TTATTATAGAATTCAGACAATGG + Intronic
984900369 4:184580919-184580941 CCAACATAGAACTCAGGCCATGG - Intergenic
986452663 5:7881687-7881709 CTAAAATAGAACTAAGCCAGGGG - Intronic
986765387 5:10921451-10921473 ATGAAATAGAGTACAGGCAAAGG - Intergenic
987460303 5:18200523-18200545 AGAAAACAGAATTCAGTCAACGG - Intergenic
988865120 5:35325525-35325547 CAAAAATAGAATTCAGCACATGG + Intergenic
989503040 5:42191663-42191685 CTAAAATAGAATTGAACTAAAGG - Intergenic
990271415 5:54145091-54145113 ATAAAATAGAATTTTGGCTATGG + Intronic
990802974 5:59626119-59626141 CTAAAATGGAAACCAGGCATTGG - Intronic
993203852 5:84853202-84853224 CTAAAGTAGAAATTAAGCAATGG - Intergenic
993225392 5:85163553-85163575 CAGAAATAGAATTCAGACTATGG - Intergenic
993311592 5:86338913-86338935 CAAAAATAGAATTCAGAATATGG + Intergenic
993678182 5:90843001-90843023 CTAACATAGACTTCAGTAAATGG + Intronic
994432799 5:99690468-99690490 GTAAAATAGAATTTAGAAAATGG - Intergenic
994520603 5:100829450-100829472 CTAAAATAGAATTCAGGCAAAGG - Intronic
994629973 5:102273213-102273235 CAGATATAGAATTCAGACAAAGG + Intronic
994642947 5:102433241-102433263 CTGAAATAGAATTCAGAATATGG - Intronic
996021137 5:118591966-118591988 CGAAAACAGAATCCAGGGAAAGG + Intergenic
997273900 5:132566219-132566241 AGTAAATAGAATTCAAGCAAGGG - Intronic
997290101 5:132724930-132724952 CTAAATTAAAATTAAAGCAATGG + Intronic
998633200 5:143924017-143924039 CTGAAAGAGAACACAGGCAAGGG - Intergenic
998665585 5:144293529-144293551 TTAAAATAGAATTTCAGCAATGG - Intronic
998979672 5:147688331-147688353 GTGAAATAGGGTTCAGGCAAGGG + Intronic
1000646229 5:163763673-163763695 CTAAAATATAAATGAGGGAAGGG + Intergenic
1001795498 5:174498891-174498913 CCAAAATAGAGCTCAGGCCATGG + Intergenic
1003255339 6:4470419-4470441 CCTAAACAGAGTTCAGGCAAAGG + Intergenic
1004810722 6:19259010-19259032 TTATAATAGATTTCAGGGAATGG + Intergenic
1006884198 6:37366865-37366887 CTAAAATAGACTTGAAACAAAGG - Intronic
1007440885 6:41859025-41859047 TTAAATTAGAATCGAGGCAATGG - Intronic
1008061258 6:46999312-46999334 CTTACATAGAATTCTGGGAATGG + Exonic
1008332196 6:50258955-50258977 CAAAAATAGAATTCAGAAAATGG - Intergenic
1008908980 6:56712754-56712776 TTAAAATAAAAATCATGCAAAGG + Intronic
1009915534 6:69990888-69990910 CTAAAATAGAAGTCAGAAAAAGG - Intronic
1010158628 6:72825267-72825289 AAAAAATAGAAATCAGGGAAGGG - Intronic
1010787803 6:80025087-80025109 CTAAAGTAAAATTAAGGAAATGG - Intronic
1011221577 6:85060111-85060133 CTAAGATAGAACTGAGACAAAGG - Intergenic
1011963766 6:93125936-93125958 ATGAAATAGAATTCAGCCAAAGG - Intergenic
1012286246 6:97392471-97392493 ATAAAATATAATTAAGGAAATGG + Intergenic
1013764211 6:113555570-113555592 CTAAAACAGAATTCATGAACTGG - Intergenic
1014208068 6:118678535-118678557 ATAAAATAGAGTTCAGTAAATGG - Intronic
1014647819 6:123996638-123996660 CCAAAATATAAATAAGGCAAAGG - Intronic
1014871899 6:126606367-126606389 CTAAAATGGAATTCGAGCATCGG - Intergenic
1015017145 6:128427367-128427389 CCTAAATAGAAGGCAGGCAAGGG - Intronic
1015135288 6:129862408-129862430 ACAGAATAGAATTCAGCCAAAGG - Intergenic
1016104492 6:140145616-140145638 CCAAAAAAGAATTCAGGACATGG + Intergenic
1016288830 6:142505869-142505891 CAGAAATAGAATTCAGACTACGG - Intergenic
1016339162 6:143042723-143042745 CTAGGATATAATTCAGGAAAGGG + Intergenic
1017061461 6:150488861-150488883 GTAAATTAGAATTCAAGAAAGGG + Intergenic
1018052623 6:160024427-160024449 CTAATAACGAACTCAGGCAAAGG - Intronic
1018091756 6:160351672-160351694 CTAAGATACAAATCATGCAAAGG + Intronic
1018252786 6:161888869-161888891 CTAAAAAAGAAATCCAGCAATGG - Intronic
1020607594 7:10357947-10357969 TAAAAATAGAAATCAGGCAGAGG - Intergenic
1021702752 7:23336052-23336074 CTAGAATGGAATAGAGGCAAGGG + Intronic
1023127346 7:36967744-36967766 ATAAAAAAGAATTCAGGCTTTGG + Intronic
1023769144 7:43538715-43538737 ATAAAATAGAATTGTTGCAAGGG + Intronic
1023788945 7:43736853-43736875 AAAAAATAGGATTTAGGCAATGG + Intergenic
1024448371 7:49509081-49509103 CTAAAACAGAATTATGGAAATGG + Intergenic
1024996272 7:55275210-55275232 CTACACTAAAATGCAGGCAAGGG + Intergenic
1025285762 7:57659529-57659551 CCAACATAGAACTCAGGCCATGG + Intergenic
1028052950 7:86207813-86207835 CTCAAACAAAACTCAGGCAAAGG - Intergenic
1030209159 7:106979559-106979581 CTAAAATAAAAGGGAGGCAACGG + Intergenic
1030488068 7:110196419-110196441 GTAAAATAAAAATAAGGCAAGGG - Intergenic
1030640475 7:112000189-112000211 CTAAATTAAAATTCAGGCAGGGG - Intronic
1031358934 7:120823173-120823195 CTAAAATAAAAGGGAGGCAAAGG + Intronic
1031421814 7:121562145-121562167 AAAAAATAGAATTCAGTCTATGG - Intergenic
1031702840 7:124945977-124945999 CAGAAATAGAATTCAGAAAATGG + Intergenic
1032501460 7:132403340-132403362 GAAAAAGAGAAGTCAGGCAAGGG + Intronic
1032646283 7:133828203-133828225 GTCAAATATATTTCAGGCAAAGG - Intronic
1032793854 7:135262009-135262031 CTTGAATAGAAATCAGGGAATGG + Intergenic
1032846424 7:135755444-135755466 TTAAAATAGAATCCAGCCAAAGG - Intergenic
1034779357 7:153863648-153863670 CTAAAATTAAATTCAGTCGATGG - Intergenic
1036155955 8:6341932-6341954 CTGAATCAGAATTCAGGCAGAGG - Intergenic
1037461568 8:19115709-19115731 CTAACATATAATTTAGGTAAAGG + Intergenic
1038233451 8:25728236-25728258 CAGAAATAGAATTCAGACTATGG - Intergenic
1038487438 8:27946851-27946873 CTAAAACAGAAATCAGGGAGGGG - Intronic
1038971250 8:32638208-32638230 ATAAAATAAAATTCATGTAATGG + Intronic
1039059084 8:33559324-33559346 AAAAAAAAGAATTTAGGCAATGG + Intronic
1039970654 8:42319056-42319078 CTAAACTTGACATCAGGCAAAGG - Intronic
1040927063 8:52695775-52695797 CAAAAATTAAAATCAGGCAATGG - Intronic
1042108515 8:65355055-65355077 CAGAAATAGAATTCAGAAAATGG - Intergenic
1043449425 8:80351573-80351595 CTAAGACAGAATCTAGGCAAGGG + Intergenic
1043761167 8:84069992-84070014 GTAAAAAAAAATTCAGACAAAGG + Intergenic
1043935965 8:86142676-86142698 CTAAAAAAGAATTCCAGAAAAGG - Intronic
1044162315 8:88935180-88935202 CAGAAATAGAATTCAGAAAATGG - Intergenic
1044217393 8:89628304-89628326 AGAAAATGGAATACAGGCAAGGG + Intergenic
1044525248 8:93243636-93243658 CTAAAATTGAATTGTGGCAATGG + Intergenic
1046140006 8:110079262-110079284 CTAAAAAAGAAATAAAGCAAAGG - Intergenic
1046246994 8:111577057-111577079 ATATAATAGAACTCAGGCAAAGG - Intergenic
1047187030 8:122642907-122642929 CTCAAACAGAATCCAGGGAAGGG + Intergenic
1048727382 8:137401472-137401494 CAAAAATCGAATTCAGGATACGG + Intergenic
1048895791 8:138990972-138990994 CCAACATAGAGTTCAGGCCATGG - Intergenic
1050745261 9:8868700-8868722 TAAAAATGGAATTCAGCCAAAGG - Intronic
1051159777 9:14194094-14194116 CTAAAATACATTTCAGGCACAGG - Intronic
1051964633 9:22812603-22812625 TTAAATTAGAATTCTGGCACGGG - Intergenic
1052132855 9:24870775-24870797 CCACAATGGAATTCAGGCATAGG + Intergenic
1052139150 9:24956360-24956382 CGAAAATAGAAGACAGGAAAAGG - Intergenic
1052389815 9:27866605-27866627 TTAAAACAGAATTTAAGCAAAGG - Intergenic
1053216715 9:36277649-36277671 ATAAAATAGACTTCAGACCATGG - Intronic
1054331087 9:63756434-63756456 CTAGAATAGACTGAAGGCAAGGG - Intergenic
1055132842 9:72794792-72794814 CTGAAATAGAATTCAGACTGTGG + Intronic
1055328122 9:75153373-75153395 CTAAAATGGAATTAAAGAAAAGG - Intergenic
1057368758 9:94450455-94450477 CTATATTAAAATTCAGGAAAAGG - Intronic
1057732479 9:97622246-97622268 CCAATGTAGAATTCAGGCCATGG + Intronic
1058354710 9:104070649-104070671 CTAAAAGAGAAGTCAATCAAGGG + Intergenic
1058565299 9:106277779-106277801 CTAAAACAGAACACAGGAAAAGG + Intergenic
1059026275 9:110635778-110635800 TTGAAATGGTATTCAGGCAAAGG - Intergenic
1059322872 9:113483036-113483058 CTAAAAGAGAATTCAGACATTGG - Intronic
1062206473 9:135340326-135340348 CTTAACTAGAATGAAGGCAAAGG - Intergenic
1202787392 9_KI270719v1_random:41234-41256 CTTAAATAGCATTTAGGCATGGG + Intergenic
1202798461 9_KI270719v1_random:149354-149376 CTAGAATAGACTGAAGGCAAGGG - Intergenic
1185770554 X:2762636-2762658 CTAAAGTAGAATTCAGCCCTTGG + Intronic
1190396910 X:49994292-49994314 CCATAATAGAATTCAGAGAAAGG + Intronic
1191722662 X:64247730-64247752 CAAAAATAGAATTCAGAATATGG - Intergenic
1192052761 X:67742077-67742099 ATGAAATAGCATACAGGCAAAGG - Intergenic
1193299172 X:79868522-79868544 CAAAAATAGAATTCAGAATATGG + Intergenic
1193749497 X:85325650-85325672 CAGAAATAGAATTCAGACTATGG - Intronic
1193851544 X:86543495-86543517 TAAAAATAGAATTCAGGATATGG + Intronic
1193915954 X:87364309-87364331 ATAAAATTGAACTTAGGCAAAGG - Intergenic
1194501741 X:94690296-94690318 CCAAACTAGAGTTCAGGCCATGG + Intergenic
1194646815 X:96468021-96468043 CTAAAATAGAAGAAAGACAATGG - Intergenic
1194774925 X:97951162-97951184 GCAAAATAGAATTCAAGAAATGG + Intergenic
1194996328 X:100595234-100595256 CTAAAGTGGAATTATGGCAATGG + Intronic
1195241605 X:102958616-102958638 CAAAAATAGAATTCAGAATATGG - Intergenic
1195574574 X:106435611-106435633 CTAAAATAGAATTCAGAGAAAGG + Intergenic
1196314332 X:114204880-114204902 ATAAAATAGAATTCAAGGCAAGG + Intergenic
1196356882 X:114805423-114805445 TTAAAATTGAAGTCAGGAAATGG - Intronic
1196621056 X:117824260-117824282 CAAAAATATAAATCAGGGAAAGG - Intergenic
1197240912 X:124122368-124122390 ATAAAATAGTATCCTGGCAATGG + Intronic
1198620294 X:138500544-138500566 GTAAAATAAAATATAGGCAATGG + Intergenic
1199525059 X:148782957-148782979 CTAAAGTATAAATCAGGAAAAGG + Intronic
1199525104 X:148783464-148783486 CTAAAATACAAGTCAGGAAAAGG - Intronic
1199863966 X:151826474-151826496 CTGAAAAGGAATTCAGACAAAGG - Intergenic
1201299708 Y:12495097-12495119 CTAAAGTAGAATTCAGCCCTTGG - Intergenic
1201362581 Y:13169189-13169211 CTAAAATAGTATTGCAGCAAAGG + Intergenic