ID: 994521242

View in Genome Browser
Species Human (GRCh38)
Location 5:100839213-100839235
Sequence CTGGGTAAATACATATTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994521242 Original CRISPR CTGGGTAAATACATATTGCA AGG Intronic
901178159 1:7319963-7319985 CTGGGTAAATAAATTTAGCAAGG - Intronic
901445823 1:9307516-9307538 CTGGCTAATTAAATTTTGCATGG + Intronic
902130424 1:14255525-14255547 CTGGGTTTATGCATATTGAATGG + Intergenic
902436564 1:16401769-16401791 TTGGGTAACTACAGGTTGCAGGG - Intronic
902773630 1:18660615-18660637 CGTGGTAAATACAGGTTGCAGGG - Intronic
905671951 1:39797247-39797269 ATGGATAAATACATATTGTATGG + Intergenic
911190412 1:94942938-94942960 CTGGGTAAATACACACTTCTGGG + Intergenic
912060793 1:105666149-105666171 CTGGGTACATACATTTGCCAAGG + Intergenic
913484159 1:119318379-119318401 CTGGGTAAATATTCACTGCAAGG + Intergenic
916006365 1:160664871-160664893 CTGGGGAAATGCAAATTTCATGG - Intergenic
916684628 1:167133255-167133277 CTGAGGAAAGACTTATTGCAGGG - Intergenic
917056803 1:170991404-170991426 CTGGGTATTTCCATATTCCAAGG + Intronic
918960543 1:191270969-191270991 CTGGGAAAAAAATTATTGCAGGG - Intergenic
919401500 1:197123548-197123570 CTTGGTATAATCATATTGCAAGG + Intronic
919988518 1:202692379-202692401 CTGGGATAATAAATATTACAGGG + Intronic
923031316 1:230251069-230251091 CTGGGTAAAAATAATTTGCATGG - Intronic
923582941 1:235235873-235235895 CAGGGTAAATACTCAGTGCATGG + Intronic
923838041 1:237636325-237636347 CTGGGTAGACACTTAGTGCATGG + Intronic
1063579647 10:7294101-7294123 GTGGGGAAGTACATATTTCATGG - Intronic
1067721979 10:48734703-48734725 CTGGCTAAATGCATATTCCTAGG + Intronic
1067973629 10:50998801-50998823 CTGGATATATCCATTTTGCAGGG - Intronic
1072910609 10:99497604-99497626 CAGGGGAAATACATCATGCAAGG - Intergenic
1072976246 10:100061445-100061467 CTGGCTAAATACAGCTTGCTGGG + Intronic
1079011307 11:16830684-16830706 CTTGGTAAATACATGGTGAATGG - Intronic
1079349693 11:19681921-19681943 CTGAGAAAATACATCTAGCAGGG + Intronic
1081209758 11:40318192-40318214 CACTGTAAATACATATTACAAGG - Intronic
1084097319 11:66920280-66920302 CTGGGTAAATACCAGTTACAGGG - Intronic
1086419598 11:86625591-86625613 CTGGATAAATATTTATTGCATGG - Intronic
1087231378 11:95669629-95669651 ATGGATAAATACATATTGTGGGG - Intergenic
1087957855 11:104311598-104311620 TTGGGTAAATACATACTGGTGGG - Intergenic
1088780238 11:113127168-113127190 CTTGTTAAATACACATTCCAGGG + Intronic
1093729108 12:22547701-22547723 ATGGATAAATAATTATTGCATGG - Intergenic
1094068747 12:26389374-26389396 TTTAGCAAATACATATTGCATGG - Intronic
1095172646 12:39054282-39054304 CTGGGTAGCTGCCTATTGCAGGG + Intergenic
1098540507 12:71651072-71651094 CTGGTTAAATACAGATTGCTAGG + Intronic
1099006072 12:77236033-77236055 CTGGGAGAAGGCATATTGCAGGG - Intergenic
1102880909 12:116484110-116484132 CTGGGTACATTTATCTTGCAAGG + Intergenic
1106374007 13:29166170-29166192 CTAGAGAAATAGATATTGCAAGG - Intronic
1106442905 13:29794761-29794783 CCTGATAAATACATTTTGCATGG - Intronic
1107744216 13:43487995-43488017 CTGGATACATTCATTTTGCAAGG + Intronic
1111107417 13:83665664-83665686 ATGGTTAAATATATATTCCAAGG - Intergenic
1112950487 13:104989829-104989851 CTGTTTAGATACATATTGCAAGG + Intergenic
1115099772 14:29684640-29684662 CTTGGTAAACACATATAGCTGGG - Intronic
1115557449 14:34554652-34554674 CTGGGTAAATACAAGGGGCAGGG + Intergenic
1116459349 14:45154098-45154120 TTGGCTAAAGACATATTGAAGGG + Intronic
1117505889 14:56402688-56402710 CTGGGTATATACATATACCTAGG + Intergenic
1118902082 14:69994493-69994515 CTGGGTACATATATAATCCAAGG - Intronic
1118968318 14:70609392-70609414 CTGGTTAATTAGAAATTGCATGG - Intergenic
1128890601 15:71328483-71328505 CTTGATAAATATATATTGAATGG - Intronic
1131297722 15:91166313-91166335 CAGTGTAATTACATATTGCATGG - Intronic
1131320679 15:91387273-91387295 CTGGGTAAATACACAAAGAAAGG - Intergenic
1134891311 16:17843977-17843999 CTGGATAATTACCTGTTGCAGGG + Intergenic
1135722136 16:24827044-24827066 GTGGCTGAATAAATATTGCAAGG + Intronic
1137533209 16:49297026-49297048 CTGGCACAATACATGTTGCATGG - Intergenic
1138785985 16:59847286-59847308 CTAGGTGAAGACATATTGGAAGG - Intergenic
1139730257 16:68937937-68937959 CTGGGTATATACATATACCTAGG + Intronic
1140100778 16:71914520-71914542 ATCAGTAAATACTTATTGCATGG + Intronic
1140554459 16:75905624-75905646 GTGGGTAAGTATATATTGGATGG - Intergenic
1140892475 16:79296986-79297008 CAGGGAACATACATTTTGCACGG + Intergenic
1143002413 17:3802951-3802973 TTGGATAAATACATACTGGATGG - Intergenic
1150867263 17:68865805-68865827 CTTGATAAATACAGATTGCTGGG + Intergenic
1151739961 17:75974299-75974321 AAGAGTAAATACATATTCCAGGG + Intronic
1154404534 18:14077107-14077129 CTGGGAAAAAACAGATTTCATGG + Intronic
1155419614 18:25640967-25640989 ATGTGTAAATGCGTATTGCAGGG - Intergenic
1157281613 18:46349896-46349918 ATGTGTAAATGCATATTGCATGG - Intronic
1157827692 18:50827143-50827165 CTTGGTACAAACATTTTGCAGGG + Intergenic
1166439427 19:42798498-42798520 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166457465 19:42954049-42954071 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166474410 19:43109268-43109290 CTTGGTAAAAACACAGTGCAGGG + Intronic
1166495054 19:43294821-43294843 CTTGGTAAAAACACAGTGCAGGG + Intergenic
928234862 2:29530595-29530617 CTGGGCAAATACCTATAGGATGG + Intronic
931508365 2:62958357-62958379 CTGGGTAATATTATATTGCATGG - Intronic
932892759 2:75611011-75611033 CAGGGCAAATACATTTTGAAAGG + Intergenic
934531509 2:95092335-95092357 CTTGGGAGATTCATATTGCATGG + Intronic
939261225 2:139812322-139812344 CTGGATAAATGAATATTGAATGG + Intergenic
939701225 2:145394008-145394030 ATGGCTAAATACATATTTGAAGG + Intergenic
944025554 2:195162235-195162257 CCTGGTAAATACAAACTGCAGGG - Intergenic
948474684 2:238209669-238209691 CTGTGTAAATACAGATTAAAAGG + Intergenic
1169673073 20:8125733-8125755 CTAGGAAAATAGATATTGGATGG + Intergenic
1169923797 20:10761904-10761926 CTGGGTAAATAGATATTTTGGGG + Intergenic
1170151813 20:13234322-13234344 CTGGGTAAAGAAATATACCATGG - Intronic
1171363911 20:24610766-24610788 CTGGGCAAATACACAGTGCCTGG - Intronic
1172205906 20:33162755-33162777 CTGGGTATATTTATCTTGCAGGG - Intronic
1178085982 21:29112430-29112452 CTAGGTTAATACTAATTGCAAGG - Intronic
1178483471 21:33001417-33001439 CTGGGTAAATATTTATTGGATGG + Intergenic
949716739 3:6940850-6940872 CTAGGAAAACTCATATTGCAGGG - Intronic
953478196 3:43224178-43224200 CTGGGTAGACACATAAAGCATGG - Intergenic
954954661 3:54508517-54508539 CTCAATAAATACTTATTGCAAGG + Intronic
954998550 3:54904713-54904735 CTGGATAAATACATGATTCAAGG + Intronic
956190077 3:66599863-66599885 ATGAGGAAATACATATAGCAAGG - Intergenic
956300543 3:67767809-67767831 CTGGGAATCTACATATTGGATGG + Intergenic
956604074 3:71053882-71053904 CTGGATAAATACATGTTGCATGG - Intronic
956761974 3:72451677-72451699 CTGGATAGATCCATATGGCAGGG + Intergenic
959484951 3:106917106-106917128 CTTGGTACAGACATCTTGCATGG - Intergenic
959947315 3:112139205-112139227 CTGGTTATATACATCATGCATGG + Intergenic
960363514 3:116743206-116743228 TTGGTTAAATACATGTGGCAAGG - Intronic
963117581 3:141744763-141744785 CTTGGTAAATAAAAATTGGAAGG + Intronic
963380093 3:144518418-144518440 CTGGAGAAAAAGATATTGCAAGG + Intergenic
965255855 3:166409887-166409909 ATGGGGAAATACATCTTTCAAGG - Intergenic
967087147 3:186106135-186106157 CTGGGTAAATGGATTTGGCACGG - Intronic
967314417 3:188137772-188137794 CTGGGTTAAGACATATTCTATGG - Intergenic
970937457 4:21590362-21590384 CTGGGGAAAAATAGATTGCAGGG + Intronic
973002212 4:44964706-44964728 ATGCTAAAATACATATTGCATGG - Intergenic
974260953 4:59522832-59522854 CTGGGAAAATCCACAGTGCAAGG + Intergenic
974471388 4:62323188-62323210 CAGGGAAAAAATATATTGCAAGG - Intergenic
974918609 4:68208069-68208091 CTGGGTATATACATATCCAAAGG + Intergenic
975415561 4:74100212-74100234 GCTGGTAAATACATATGGCATGG - Intergenic
976035442 4:80813776-80813798 ATGTGTAAATACAGATTGAAGGG + Intronic
979268937 4:118736298-118736320 CTGGGTTAAGACATATGGCTGGG - Intronic
982321861 4:154085193-154085215 CTTGGGAAACACATATTGCCAGG + Intergenic
986114560 5:4759452-4759474 CTGGATAAATACATCTGGTATGG - Intergenic
987968514 5:24909531-24909553 CTGGTCAAACACATATAGCATGG - Intergenic
988418136 5:30971895-30971917 CTAGCTAAATAAATTTTGCATGG + Intergenic
990559036 5:56965431-56965453 CTGGGTATAAAAATCTTGCAGGG + Intronic
994521242 5:100839213-100839235 CTGGGTAAATACATATTGCAAGG + Intronic
995482037 5:112603103-112603125 CTGGATAAATAAATATGGAAAGG - Intergenic
998399423 5:141840777-141840799 CTCAGTAAATACAAATTGGATGG + Intergenic
999218534 5:149956297-149956319 ATGGGTATATACATACTGGAGGG + Intergenic
999479096 5:151928834-151928856 CTCAGTAAATATTTATTGCAAGG + Intergenic
999670819 5:153957921-153957943 CAGGGGAGATACGTATTGCAGGG + Intergenic
1000148511 5:158476691-158476713 CTGAGTAAATATTTCTTGCATGG + Intergenic
1000290009 5:159861294-159861316 CTGGGTAAACACATCTTGAGGGG + Intergenic
1000663689 5:163968169-163968191 ATGGTTAAATAAATATTGCATGG + Intergenic
1001006463 5:168055273-168055295 CTTGATAAATATTTATTGCATGG + Intronic
1003681197 6:8258919-8258941 CTGGGTAAGTACCCATTGCTGGG - Intergenic
1006413398 6:33889068-33889090 CTGAGTAAAGACATATTCCCGGG - Intergenic
1008271625 6:49496455-49496477 CTGGCTAACTACATAATGGAGGG + Intergenic
1010606826 6:77900332-77900354 CTGGGTATATATATATAGAAAGG + Intronic
1012016592 6:93860252-93860274 CTGGGCAGATACAGATTGCTAGG + Intergenic
1012525961 6:100177974-100177996 CTGGGGAAATACATAGTACAGGG + Intergenic
1013802086 6:113958379-113958401 TTGGGTTAATACATATTGGTAGG - Intronic
1015466588 6:133555067-133555089 CTGTGAAAATACAGATTTCAGGG + Intergenic
1021560416 7:21963778-21963800 CTGGGTGAAGACACATTGCTGGG + Intergenic
1023507024 7:40910413-40910435 CTGGGTCAAGAGATATTGCAAGG + Intergenic
1027535691 7:79398128-79398150 CTTGGAAAATACATATGACAAGG - Intronic
1027751475 7:82152736-82152758 CTGGGTAATTACATTTTCTAAGG - Intronic
1028282010 7:88942105-88942127 ATGAGTAGATACATATTTCATGG - Intronic
1031625227 7:123985085-123985107 CTGGGCAAATAAATAAAGCAAGG + Intergenic
1032235164 7:130115270-130115292 ATGCTTAAATACATATTGGATGG - Intronic
1032645530 7:133819486-133819508 CTGGATGAATGCATGTTGCATGG + Intronic
1032761045 7:134942152-134942174 CCGGGGAAATCCACATTGCAGGG - Intronic
1032866094 7:135925708-135925730 CTGGTTAAATACATTTTAAAGGG - Intergenic
1037602903 8:20413103-20413125 TTGGTTAAATACAAATTGCTGGG - Intergenic
1039179070 8:34843439-34843461 TTCAGTAAATATATATTGCATGG + Intergenic
1039619949 8:38987545-38987567 CTGGGAGAAAACATATTGCTTGG + Intronic
1040395151 8:46991757-46991779 CTGAGTACATACATACTCCAGGG - Intergenic
1040587150 8:48755095-48755117 CTGGGGAAATACATATTTCTCGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1046185134 8:110703783-110703805 GTGGGTTAATACATATGGTATGG + Intergenic
1046560832 8:115835357-115835379 GTGGGTAAATAAATATTCTATGG - Intergenic
1048216102 8:132496810-132496832 CTGGGTAAGTGCTTACTGCATGG + Intergenic
1048243348 8:132766284-132766306 CTTGGTCAAAGCATATTGCATGG + Intergenic
1056281361 9:85044112-85044134 CTAGGTAAATCCATATCTCAGGG + Intergenic
1058131050 9:101253855-101253877 CAGGGTATATACATATTTAAGGG - Intronic
1059040393 9:110808432-110808454 CTGAGTCATTACATATTGGAAGG + Intergenic
1185534805 X:852551-852573 AGGGGAAGATACATATTGCAGGG - Intergenic
1185883877 X:3764555-3764577 ATGGATGAATACATATTGAATGG - Intergenic
1186244242 X:7603992-7604014 ATGTGTAAAGACATATTTCAGGG + Intergenic
1187137616 X:16563118-16563140 CTGTTAAAATACAGATTGCAAGG - Intergenic
1187171952 X:16860830-16860852 CCCGGTAAATACATACTTCAGGG + Intronic
1188464566 X:30465086-30465108 CATGGAAACTACATATTGCAGGG - Intergenic
1193178669 X:78426955-78426977 CTGGGTATATATATATTCAAAGG + Intergenic
1193514083 X:82441745-82441767 GTGGGTAAATTAATATTGCAGGG - Intergenic
1194080008 X:89450053-89450075 CTGGATAAATACTTATCTCAGGG + Intergenic
1196291094 X:113942408-113942430 TTGGATAAATACTTATTGCTTGG + Intergenic
1197260834 X:124315959-124315981 CTTGGAAAATACACAATGCATGG + Intronic
1197287252 X:124610300-124610322 CTGTATAAATACGTATTGCATGG - Intronic
1198438725 X:136641154-136641176 CTGGGAAAATACTTATTGAAAGG + Intergenic
1201354554 Y:13083333-13083355 CTGGGTACACACACTTTGCATGG - Intergenic
1202248353 Y:22842703-22842725 ATGGATAATGACATATTGCAAGG + Intergenic
1202401341 Y:24476451-24476473 ATGGATAATGACATATTGCAAGG + Intergenic
1202469439 Y:25193635-25193657 ATGGATAATGACATATTGCAAGG - Intergenic