ID: 994533634

View in Genome Browser
Species Human (GRCh38)
Location 5:100999614-100999636
Sequence GCTCTGCCTCGGGTTGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994533634_994533644 30 Left 994533634 5:100999614-100999636 CCTCCACCAACCCGAGGCAGAGC No data
Right 994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG No data
994533634_994533643 29 Left 994533634 5:100999614-100999636 CCTCCACCAACCCGAGGCAGAGC No data
Right 994533643 5:100999666-100999688 AAGGGAGAGTGAAGTGAGTGTGG No data
994533634_994533642 11 Left 994533634 5:100999614-100999636 CCTCCACCAACCCGAGGCAGAGC No data
Right 994533642 5:100999648-100999670 AGAATCAGTATGCTCAGGAAGGG No data
994533634_994533640 6 Left 994533634 5:100999614-100999636 CCTCCACCAACCCGAGGCAGAGC No data
Right 994533640 5:100999643-100999665 GAAAGAGAATCAGTATGCTCAGG No data
994533634_994533641 10 Left 994533634 5:100999614-100999636 CCTCCACCAACCCGAGGCAGAGC No data
Right 994533641 5:100999647-100999669 GAGAATCAGTATGCTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994533634 Original CRISPR GCTCTGCCTCGGGTTGGTGG AGG (reversed) Intergenic
No off target data available for this crispr