ID: 994533635

View in Genome Browser
Species Human (GRCh38)
Location 5:100999617-100999639
Sequence GCTGCTCTGCCTCGGGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994533635_994533642 8 Left 994533635 5:100999617-100999639 CCACCAACCCGAGGCAGAGCAGC No data
Right 994533642 5:100999648-100999670 AGAATCAGTATGCTCAGGAAGGG No data
994533635_994533644 27 Left 994533635 5:100999617-100999639 CCACCAACCCGAGGCAGAGCAGC No data
Right 994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG No data
994533635_994533643 26 Left 994533635 5:100999617-100999639 CCACCAACCCGAGGCAGAGCAGC No data
Right 994533643 5:100999666-100999688 AAGGGAGAGTGAAGTGAGTGTGG No data
994533635_994533641 7 Left 994533635 5:100999617-100999639 CCACCAACCCGAGGCAGAGCAGC No data
Right 994533641 5:100999647-100999669 GAGAATCAGTATGCTCAGGAAGG No data
994533635_994533640 3 Left 994533635 5:100999617-100999639 CCACCAACCCGAGGCAGAGCAGC No data
Right 994533640 5:100999643-100999665 GAAAGAGAATCAGTATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994533635 Original CRISPR GCTGCTCTGCCTCGGGTTGG TGG (reversed) Intergenic