ID: 994533639

View in Genome Browser
Species Human (GRCh38)
Location 5:100999625-100999647
Sequence CTTTCCATGCTGCTCTGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994533639_994533641 -1 Left 994533639 5:100999625-100999647 CCGAGGCAGAGCAGCATGGAAAG No data
Right 994533641 5:100999647-100999669 GAGAATCAGTATGCTCAGGAAGG No data
994533639_994533644 19 Left 994533639 5:100999625-100999647 CCGAGGCAGAGCAGCATGGAAAG No data
Right 994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG No data
994533639_994533640 -5 Left 994533639 5:100999625-100999647 CCGAGGCAGAGCAGCATGGAAAG No data
Right 994533640 5:100999643-100999665 GAAAGAGAATCAGTATGCTCAGG No data
994533639_994533642 0 Left 994533639 5:100999625-100999647 CCGAGGCAGAGCAGCATGGAAAG No data
Right 994533642 5:100999648-100999670 AGAATCAGTATGCTCAGGAAGGG No data
994533639_994533643 18 Left 994533639 5:100999625-100999647 CCGAGGCAGAGCAGCATGGAAAG No data
Right 994533643 5:100999666-100999688 AAGGGAGAGTGAAGTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994533639 Original CRISPR CTTTCCATGCTGCTCTGCCT CGG (reversed) Intergenic
No off target data available for this crispr