ID: 994533640

View in Genome Browser
Species Human (GRCh38)
Location 5:100999643-100999665
Sequence GAAAGAGAATCAGTATGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994533635_994533640 3 Left 994533635 5:100999617-100999639 CCACCAACCCGAGGCAGAGCAGC No data
Right 994533640 5:100999643-100999665 GAAAGAGAATCAGTATGCTCAGG No data
994533632_994533640 8 Left 994533632 5:100999612-100999634 CCCCTCCACCAACCCGAGGCAGA No data
Right 994533640 5:100999643-100999665 GAAAGAGAATCAGTATGCTCAGG No data
994533631_994533640 11 Left 994533631 5:100999609-100999631 CCACCCCTCCACCAACCCGAGGC No data
Right 994533640 5:100999643-100999665 GAAAGAGAATCAGTATGCTCAGG No data
994533639_994533640 -5 Left 994533639 5:100999625-100999647 CCGAGGCAGAGCAGCATGGAAAG No data
Right 994533640 5:100999643-100999665 GAAAGAGAATCAGTATGCTCAGG No data
994533638_994533640 -4 Left 994533638 5:100999624-100999646 CCCGAGGCAGAGCAGCATGGAAA No data
Right 994533640 5:100999643-100999665 GAAAGAGAATCAGTATGCTCAGG No data
994533636_994533640 0 Left 994533636 5:100999620-100999642 CCAACCCGAGGCAGAGCAGCATG No data
Right 994533640 5:100999643-100999665 GAAAGAGAATCAGTATGCTCAGG No data
994533634_994533640 6 Left 994533634 5:100999614-100999636 CCTCCACCAACCCGAGGCAGAGC No data
Right 994533640 5:100999643-100999665 GAAAGAGAATCAGTATGCTCAGG No data
994533633_994533640 7 Left 994533633 5:100999613-100999635 CCCTCCACCAACCCGAGGCAGAG No data
Right 994533640 5:100999643-100999665 GAAAGAGAATCAGTATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994533640 Original CRISPR GAAAGAGAATCAGTATGCTC AGG Intergenic
No off target data available for this crispr