ID: 994533643

View in Genome Browser
Species Human (GRCh38)
Location 5:100999666-100999688
Sequence AAGGGAGAGTGAAGTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994533635_994533643 26 Left 994533635 5:100999617-100999639 CCACCAACCCGAGGCAGAGCAGC No data
Right 994533643 5:100999666-100999688 AAGGGAGAGTGAAGTGAGTGTGG No data
994533639_994533643 18 Left 994533639 5:100999625-100999647 CCGAGGCAGAGCAGCATGGAAAG No data
Right 994533643 5:100999666-100999688 AAGGGAGAGTGAAGTGAGTGTGG No data
994533633_994533643 30 Left 994533633 5:100999613-100999635 CCCTCCACCAACCCGAGGCAGAG No data
Right 994533643 5:100999666-100999688 AAGGGAGAGTGAAGTGAGTGTGG No data
994533634_994533643 29 Left 994533634 5:100999614-100999636 CCTCCACCAACCCGAGGCAGAGC No data
Right 994533643 5:100999666-100999688 AAGGGAGAGTGAAGTGAGTGTGG No data
994533638_994533643 19 Left 994533638 5:100999624-100999646 CCCGAGGCAGAGCAGCATGGAAA No data
Right 994533643 5:100999666-100999688 AAGGGAGAGTGAAGTGAGTGTGG No data
994533636_994533643 23 Left 994533636 5:100999620-100999642 CCAACCCGAGGCAGAGCAGCATG No data
Right 994533643 5:100999666-100999688 AAGGGAGAGTGAAGTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994533643 Original CRISPR AAGGGAGAGTGAAGTGAGTG TGG Intergenic
No off target data available for this crispr