ID: 994533644

View in Genome Browser
Species Human (GRCh38)
Location 5:100999667-100999689
Sequence AGGGAGAGTGAAGTGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994533638_994533644 20 Left 994533638 5:100999624-100999646 CCCGAGGCAGAGCAGCATGGAAA No data
Right 994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG No data
994533634_994533644 30 Left 994533634 5:100999614-100999636 CCTCCACCAACCCGAGGCAGAGC No data
Right 994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG No data
994533639_994533644 19 Left 994533639 5:100999625-100999647 CCGAGGCAGAGCAGCATGGAAAG No data
Right 994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG No data
994533636_994533644 24 Left 994533636 5:100999620-100999642 CCAACCCGAGGCAGAGCAGCATG No data
Right 994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG No data
994533635_994533644 27 Left 994533635 5:100999617-100999639 CCACCAACCCGAGGCAGAGCAGC No data
Right 994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994533644 Original CRISPR AGGGAGAGTGAAGTGAGTGT GGG Intergenic
No off target data available for this crispr