ID: 994538929

View in Genome Browser
Species Human (GRCh38)
Location 5:101069729-101069751
Sequence TTCAAAAAGATGTAGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994538929_994538932 -10 Left 994538929 5:101069729-101069751 CCTTGGCCCTACATCTTTTTGAA No data
Right 994538932 5:101069742-101069764 TCTTTTTGAAGTATCATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994538929 Original CRISPR TTCAAAAAGATGTAGGGCCA AGG (reversed) Intergenic
No off target data available for this crispr