ID: 994538932

View in Genome Browser
Species Human (GRCh38)
Location 5:101069742-101069764
Sequence TCTTTTTGAAGTATCATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994538927_994538932 8 Left 994538927 5:101069711-101069733 CCTCTGGGGAAAAAATATCCTTG No data
Right 994538932 5:101069742-101069764 TCTTTTTGAAGTATCATCTGAGG No data
994538923_994538932 25 Left 994538923 5:101069694-101069716 CCTTGGATTTTACTCTTCCTCTG No data
Right 994538932 5:101069742-101069764 TCTTTTTGAAGTATCATCTGAGG No data
994538929_994538932 -10 Left 994538929 5:101069729-101069751 CCTTGGCCCTACATCTTTTTGAA No data
Right 994538932 5:101069742-101069764 TCTTTTTGAAGTATCATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994538932 Original CRISPR TCTTTTTGAAGTATCATCTG AGG Intergenic
No off target data available for this crispr