ID: 994539518

View in Genome Browser
Species Human (GRCh38)
Location 5:101076899-101076921
Sequence ATTTAATTGCAGATGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994539518_994539524 16 Left 994539518 5:101076899-101076921 CCTGCCATCATCTGCAATTAAAT No data
Right 994539524 5:101076938-101076960 GCAACTCTTGGCTTGCTATTGGG No data
994539518_994539520 -8 Left 994539518 5:101076899-101076921 CCTGCCATCATCTGCAATTAAAT No data
Right 994539520 5:101076914-101076936 AATTAAATAAGCTCCTTTTGAGG No data
994539518_994539523 15 Left 994539518 5:101076899-101076921 CCTGCCATCATCTGCAATTAAAT No data
Right 994539523 5:101076937-101076959 AGCAACTCTTGGCTTGCTATTGG No data
994539518_994539521 4 Left 994539518 5:101076899-101076921 CCTGCCATCATCTGCAATTAAAT No data
Right 994539521 5:101076926-101076948 TCCTTTTGAGGAGCAACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994539518 Original CRISPR ATTTAATTGCAGATGATGGC AGG (reversed) Intergenic
No off target data available for this crispr