ID: 994546917

View in Genome Browser
Species Human (GRCh38)
Location 5:101178347-101178369
Sequence CCTGACATGGAGTAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994546912_994546917 10 Left 994546912 5:101178314-101178336 CCATGATTCAGAATTGTACTTTT No data
Right 994546917 5:101178347-101178369 CCTGACATGGAGTAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994546917 Original CRISPR CCTGACATGGAGTAGCTGGA GGG Intergenic
No off target data available for this crispr