ID: 994547701

View in Genome Browser
Species Human (GRCh38)
Location 5:101187588-101187610
Sequence CTTTTATCTGAGAAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994547697_994547701 22 Left 994547697 5:101187543-101187565 CCCCTTGGAAAGAGCAAAATAGT No data
Right 994547701 5:101187588-101187610 CTTTTATCTGAGAAGGAACATGG No data
994547699_994547701 20 Left 994547699 5:101187545-101187567 CCTTGGAAAGAGCAAAATAGTGT No data
Right 994547701 5:101187588-101187610 CTTTTATCTGAGAAGGAACATGG No data
994547696_994547701 23 Left 994547696 5:101187542-101187564 CCCCCTTGGAAAGAGCAAAATAG No data
Right 994547701 5:101187588-101187610 CTTTTATCTGAGAAGGAACATGG No data
994547698_994547701 21 Left 994547698 5:101187544-101187566 CCCTTGGAAAGAGCAAAATAGTG No data
Right 994547701 5:101187588-101187610 CTTTTATCTGAGAAGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994547701 Original CRISPR CTTTTATCTGAGAAGGAACA TGG Intergenic
No off target data available for this crispr