ID: 994553728

View in Genome Browser
Species Human (GRCh38)
Location 5:101270147-101270169
Sequence CTATATCAACAAAAGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994553727_994553728 2 Left 994553727 5:101270122-101270144 CCTGATTTCAAGACTTATTGCAA No data
Right 994553728 5:101270147-101270169 CTATATCAACAAAAGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994553728 Original CRISPR CTATATCAACAAAAGCAGTG TGG Intergenic
No off target data available for this crispr