ID: 994559038

View in Genome Browser
Species Human (GRCh38)
Location 5:101344371-101344393
Sequence CTGCCCTACATGAATTAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994559032_994559038 28 Left 994559032 5:101344320-101344342 CCAAGGGGAACACTTGAGGCTTA No data
Right 994559038 5:101344371-101344393 CTGCCCTACATGAATTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994559038 Original CRISPR CTGCCCTACATGAATTAGTG GGG Intergenic
No off target data available for this crispr