ID: 994562593

View in Genome Browser
Species Human (GRCh38)
Location 5:101395191-101395213
Sequence CACAAGAAAGTGCCACCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994562593_994562595 -7 Left 994562593 5:101395191-101395213 CCATGTGGTGGCACTTTCTTGTG No data
Right 994562595 5:101395207-101395229 TCTTGTGGTCTCCGCCTTCCAGG No data
994562593_994562597 0 Left 994562593 5:101395191-101395213 CCATGTGGTGGCACTTTCTTGTG No data
Right 994562597 5:101395214-101395236 GTCTCCGCCTTCCAGGGAACAGG No data
994562593_994562596 -6 Left 994562593 5:101395191-101395213 CCATGTGGTGGCACTTTCTTGTG No data
Right 994562596 5:101395208-101395230 CTTGTGGTCTCCGCCTTCCAGGG No data
994562593_994562600 9 Left 994562593 5:101395191-101395213 CCATGTGGTGGCACTTTCTTGTG No data
Right 994562600 5:101395223-101395245 TTCCAGGGAACAGGAATTTTAGG 0: 21
1: 33
2: 23
3: 73
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994562593 Original CRISPR CACAAGAAAGTGCCACCACA TGG (reversed) Intergenic
No off target data available for this crispr