ID: 994562600

View in Genome Browser
Species Human (GRCh38)
Location 5:101395223-101395245
Sequence TTCCAGGGAACAGGAATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994562592_994562600 17 Left 994562592 5:101395183-101395205 CCTTGTAACCATGTGGTGGCACT No data
Right 994562600 5:101395223-101395245 TTCCAGGGAACAGGAATTTTAGG No data
994562593_994562600 9 Left 994562593 5:101395191-101395213 CCATGTGGTGGCACTTTCTTGTG No data
Right 994562600 5:101395223-101395245 TTCCAGGGAACAGGAATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994562600 Original CRISPR TTCCAGGGAACAGGAATTTT AGG Intergenic