ID: 994567314

View in Genome Browser
Species Human (GRCh38)
Location 5:101466629-101466651
Sequence AGCCACATGCAGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994567310_994567314 10 Left 994567310 5:101466596-101466618 CCTATTTAATAAATTGTGCTGGG 0: 66
1: 12336
2: 7907
3: 5760
4: 4412
Right 994567314 5:101466629-101466651 AGCCACATGCAGAAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994567314 Original CRISPR AGCCACATGCAGAAGATGGA AGG Intergenic
No off target data available for this crispr